Incidental Mutation 'R3913:Tubb3'
ID309507
Institutional Source Beutler Lab
Gene Symbol Tubb3
Ensembl Gene ENSMUSG00000062380
Gene Nametubulin, beta 3 class III
SynonymsbetaIII-tubulin, 3200002H15Rik
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123411424-123422015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123421009 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 227 (H227R)
Ref Sequence ENSEMBL: ENSMUSP00000071134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071134] [ENSMUST00000127664] [ENSMUST00000212743] [ENSMUST00000212883]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071134
AA Change: H227R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071134
Gene: ENSMUSG00000062380
AA Change: H227R

DomainStartEndE-ValueType
Tubulin 47 244 8.63e-65 SMART
Tubulin_C 246 383 1.35e-48 SMART
low complexity region 427 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212743
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Meta Mutation Damage Score 0.9411 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit neonatal lethality associated with respiratory distress, abnormal corpus callosum morphology, abnormal cranial nerves, and defective axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Tubb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Tubb3 APN 8 123420966 missense probably benign 0.20
IGL02208:Tubb3 APN 8 123420864 missense probably damaging 1.00
IGL02253:Tubb3 APN 8 123420820 missense probably benign 0.17
IGL02669:Tubb3 APN 8 123421117 missense probably damaging 0.98
F5770:Tubb3 UTSW 8 123411675 splice site probably benign
PIT4810001:Tubb3 UTSW 8 123421657 missense possibly damaging 0.72
R1164:Tubb3 UTSW 8 123421447 missense probably damaging 1.00
R2074:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R2075:Tubb3 UTSW 8 123421270 missense probably damaging 1.00
R2091:Tubb3 UTSW 8 123421678 unclassified probably null
R3012:Tubb3 UTSW 8 123421236 missense probably damaging 1.00
R3951:Tubb3 UTSW 8 123421264 missense probably damaging 0.99
R4609:Tubb3 UTSW 8 123420919 missense probably damaging 1.00
R5054:Tubb3 UTSW 8 123420868 missense probably damaging 0.99
R5256:Tubb3 UTSW 8 123421652 missense probably benign
R5690:Tubb3 UTSW 8 123421306 missense probably benign 0.14
R7638:Tubb3 UTSW 8 123421161 missense probably benign 0.04
Z1088:Tubb3 UTSW 8 123421534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCATGAACACCTTCAGCG -3'
(R):5'- TCGAACATCTGCTGCGTGAG -3'

Sequencing Primer
(F):5'- ATGAACACCTTCAGCGTGGTG -3'
(R):5'- TGAGCTCAGGCACCGTCAG -3'
Posted On2015-04-17