Mutagenetix > Incidental Mutations

Incidental Mutation 'R3913:Mst1r'

309513

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

040911-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.316) question?

Stock #

R3913 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 107914746 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 827 (R827Q)

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

Predicted Effect

probably benign
Transcript: ENSMUST00000035203
AA Change: R827Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: R827Q

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195113

Predicted Effect

probably benign
Transcript: ENSMUST00000195617

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
Adh7	T	A	3: 138,221,780	V29E	probably damaging	Het
Adra1d	T	A	2: 131,562,155	D5V	probably damaging	Het
Arid1b	A	G	17: 5,342,257	I2021V	possibly damaging	Het
Birc6	A	T	17: 74,573,613	R462*	probably null	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Crybg1	T	C	10: 43,998,763	D783G	possibly damaging	Het
Dcaf15	T	C	8: 84,099,165	Y271C	probably damaging	Het
Dcun1d2	A	C	8: 13,281,082	M16R	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Dnttip2	T	C	3: 122,275,391	V85A	possibly damaging	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Exoc7	T	C	11: 116,306,905	D27G	probably benign	Het
Gdpd5	A	G	7: 99,438,339	D70G	probably null	Het
Glyr1	A	G	16: 5,031,913	F199L	probably damaging	Het
Golga4	T	A	9: 118,538,971	M414K	probably damaging	Het
Gpr132	C	A	12: 112,853,020	W62L	probably benign	Het
Gpr179	A	T	11: 97,334,765	V2188E	probably benign	Het
Ilf3	C	T	9: 21,398,126	A526V	possibly damaging	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Kcnab2	A	G	4: 152,395,232	V187A	probably damaging	Het
Kcnj15	C	T	16: 95,296,470	T317I	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl30	T	C	1: 91,359,444	V484A	possibly damaging	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Liph	G	T	16: 21,962,259		probably benign	Het
Lrrc7	G	A	3: 158,291,952	L158F	probably damaging	Het
Maml1	T	C	11: 50,263,432	T602A	probably benign	Het
Mast4	A	G	13: 102,758,669	L782P	probably damaging	Het
Mei4	A	G	9: 81,890,263	K43R	probably benign	Het
Mettl4	A	G	17: 94,740,532	V227A	probably benign	Het
Olfm1	A	G	2: 28,208,174	T83A	possibly damaging	Het
Olfr1022	T	C	2: 85,868,771	Y60H	probably damaging	Het
Olfr390	G	T	11: 73,787,696	G253W	probably damaging	Het
Parp4	A	G	14: 56,620,518	E869G	probably damaging	Het
Pate4	C	A	9: 35,611,844	M1I	probably null	Het
Patj	A	G	4: 98,569,101	D1280G	probably damaging	Het
Ppargc1b	T	C	18: 61,311,376	S255G	probably damaging	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Rlim	T	C	X: 103,962,661	T545A	probably benign	Het
Robo2	A	T	16: 74,035,005	D262E	probably damaging	Het
Sec14l5	A	G	16: 5,147,856		probably benign	Het
Sema4b	A	G	7: 80,220,474	S467G	probably benign	Het
Setd2	C	T	9: 110,551,046	R1310C	probably damaging	Het
Sh3d19	T	C	3: 86,084,776	I37T	probably damaging	Het
Slc23a3	T	A	1: 75,128,922	I422F	probably benign	Het
Snap91	T	C	9: 86,792,557	T534A	possibly damaging	Het
Son	A	T	16: 91,660,111		probably benign	Het
Tnks	A	T	8: 34,873,074	S463R	probably damaging	Het
Tubb3	A	G	8: 123,421,009	H227R	possibly damaging	Het
Tyw1	T	A	5: 130,259,035	V36D	probably damaging	Het
Vwa5a	T	C	9: 38,734,743	I469T	probably damaging	Het
Zdhhc8	A	G	16: 18,226,723	L311P	possibly damaging	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCATGGCACTTCACGCTATC -3'
(R):5'- CAGAAGGATCAGCCAGAGTC -3'

Sequencing Primer
(F):5'- TCCATGATGGACAAAGTACAGTG -3'
(R):5'- CCACCTCAACTTTAACTGAATGTTC -3'

Posted On

2015-04-17