Incidental Mutation 'R3913:Golga4'
ID309515
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Namegolgi autoantigen, golgin subfamily a, 4
Synonymsgolgin-245, Olp-1
MMRRC Submission 040911-MU
Accession Numbers

Genbank: NM_018748; MGI: 1859646  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location118506267-118582519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118538971 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 414 (M414K)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097] [ENSMUST00000212461]
Predicted Effect probably damaging
Transcript: ENSMUST00000084820
AA Change: M414K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: M414K

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212097
AA Change: M386K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000212183
AA Change: M89K
Predicted Effect possibly damaging
Transcript: ENSMUST00000212461
AA Change: M423K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118514271 critical splice donor site probably null
IGL00801:Golga4 APN 9 118538926 missense probably damaging 0.98
IGL01395:Golga4 APN 9 118535373 missense probably damaging 1.00
IGL01472:Golga4 APN 9 118532574 missense probably damaging 1.00
IGL01519:Golga4 APN 9 118527092 missense probably damaging 1.00
IGL01563:Golga4 APN 9 118527006 splice site probably benign
IGL02593:Golga4 APN 9 118555566 unclassified probably benign
IGL02803:Golga4 APN 9 118535460 missense probably benign
IGL02939:Golga4 APN 9 118535454 missense probably benign 0.01
IGL02939:Golga4 APN 9 118534632 missense probably damaging 1.00
IGL03123:Golga4 APN 9 118536885 missense probably damaging 1.00
IGL03334:Golga4 APN 9 118537233 splice site probably benign
F5770:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118553457 missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118553453 missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118560740 critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118568993 missense probably benign 0.00
R0362:Golga4 UTSW 9 118555785 missense probably benign 0.13
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0974:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R1128:Golga4 UTSW 9 118548784 missense probably benign 0.40
R1384:Golga4 UTSW 9 118565651 missense probably damaging 0.99
R1435:Golga4 UTSW 9 118535440 missense probably benign 0.00
R1513:Golga4 UTSW 9 118555732 missense probably benign 0.02
R1818:Golga4 UTSW 9 118572987 missense probably damaging 1.00
R2083:Golga4 UTSW 9 118532590 missense probably damaging 1.00
R2243:Golga4 UTSW 9 118556904 missense probably benign 0.06
R2355:Golga4 UTSW 9 118560742 missense probably benign 0.00
R2518:Golga4 UTSW 9 118556612 missense probably damaging 1.00
R2921:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118557380 missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118534647 missense probably benign 0.16
R3909:Golga4 UTSW 9 118558736 missense possibly damaging 0.82
R4321:Golga4 UTSW 9 118556435 missense probably damaging 1.00
R4358:Golga4 UTSW 9 118551878 missense probably benign 0.16
R4483:Golga4 UTSW 9 118514186 missense probably damaging 1.00
R4515:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4518:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4519:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4545:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4546:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4580:Golga4 UTSW 9 118557259 missense probably benign 0.00
R4918:Golga4 UTSW 9 118558145 missense probably damaging 1.00
R5007:Golga4 UTSW 9 118558300 missense probably benign
R5045:Golga4 UTSW 9 118565656 missense probably benign
R5232:Golga4 UTSW 9 118506558 critical splice donor site probably null
R5256:Golga4 UTSW 9 118556501 missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118559057 nonsense probably null
R5567:Golga4 UTSW 9 118558183 missense probably damaging 1.00
R5576:Golga4 UTSW 9 118553534 missense probably benign 0.13
R5771:Golga4 UTSW 9 118558283 missense probably damaging 0.96
R5807:Golga4 UTSW 9 118527130 missense probably damaging 0.99
R5860:Golga4 UTSW 9 118558106 missense probably damaging 1.00
R6012:Golga4 UTSW 9 118559696 missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118558627 nonsense probably null
R6299:Golga4 UTSW 9 118557370 missense probably benign 0.03
R6467:Golga4 UTSW 9 118536792 missense probably damaging 1.00
R6552:Golga4 UTSW 9 118514231 missense probably damaging 1.00
R6688:Golga4 UTSW 9 118514210 missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118548779 missense probably damaging 1.00
R6987:Golga4 UTSW 9 118558532 missense probably benign
R7212:Golga4 UTSW 9 118536840 missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118559495 missense probably benign
R7431:Golga4 UTSW 9 118559731 missense probably damaging 1.00
R7641:Golga4 UTSW 9 118557575 missense probably benign 0.05
R7727:Golga4 UTSW 9 118548702 missense probably damaging 1.00
R7729:Golga4 UTSW 9 118556063 missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118532575 missense probably damaging 1.00
R7849:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118556366 missense probably damaging 1.00
R7976:Golga4 UTSW 9 118536768 missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118532559 missense probably damaging 1.00
R8378:Golga4 UTSW 9 118558322 missense probably benign 0.03
R8514:Golga4 UTSW 9 118555796 missense possibly damaging 0.47
RF022:Golga4 UTSW 9 118557989 missense probably damaging 1.00
V7583:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGAGAGTCTTGCACTGTCC -3'
(R):5'- GAGGCTTTCTCCAAACAGCAC -3'

Sequencing Primer
(F):5'- AGTCTTGCACTGTCCTTAGTAAGAG -3'
(R):5'- ACAGCACTTTCTCATCAGGAGTC -3'
Posted On2015-04-17