Incidental Mutation 'R3913:Maml1'
ID309518
Institutional Source Beutler Lab
Gene Symbol Maml1
Ensembl Gene ENSMUSG00000050567
Gene Namemastermind like transcriptional coactivator 1
SynonymsD930008C07Rik, Mam-1
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3913 (G1)
Quality Score209
Status Validated
Chromosome11
Chromosomal Location50255634-50292311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50263432 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 602 (T602A)
Ref Sequence ENSEMBL: ENSMUSP00000059210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059458]
Predicted Effect probably benign
Transcript: ENSMUST00000059458
AA Change: T602A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059210
Gene: ENSMUSG00000050567
AA Change: T602A

DomainStartEndE-ValueType
MamL-1 14 73 1.04e-32 SMART
low complexity region 77 102 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 588 600 N/A INTRINSIC
coiled coil region 627 671 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135868
AA Change: T516A
SMART Domains Protein: ENSMUSP00000118188
Gene: ENSMUSG00000050567
AA Change: T516A

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
coiled coil region 541 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222498
Meta Mutation Damage Score 0.002 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is the human homolog of mastermind, a Drosophila protein that plays a role in the Notch signaling pathway involved in cell-fate determination. There is in vitro evidence that the human homolog forms a complex with the intracellular portion of human Notch receptors and can increase expression of a Notch-induced gene. This evidence supports its proposed function as a transcriptional co-activator in the Notch signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality, reduced size, and skeletal muscle degeneration and necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tnks A T 8: 34,873,074 S463R probably damaging Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Maml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Maml1 APN 11 50258714 missense probably damaging 0.97
IGL01326:Maml1 APN 11 50265888 missense probably benign 0.30
IGL01469:Maml1 APN 11 50266526 missense probably damaging 1.00
IGL02336:Maml1 APN 11 50258165 missense probably benign 0.00
IGL02690:Maml1 APN 11 50258630 missense probably damaging 1.00
R0674:Maml1 UTSW 11 50258058 missense probably benign 0.28
R1497:Maml1 UTSW 11 50265707 missense possibly damaging 0.51
R1641:Maml1 UTSW 11 50266947 missense probably benign 0.16
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1899:Maml1 UTSW 11 50266130 missense probably damaging 1.00
R2496:Maml1 UTSW 11 50258544 missense probably benign
R4018:Maml1 UTSW 11 50265784 missense probably damaging 1.00
R4091:Maml1 UTSW 11 50291829 missense probably benign 0.00
R4202:Maml1 UTSW 11 50257913 missense probably damaging 1.00
R4205:Maml1 UTSW 11 50257913 missense probably damaging 1.00
R4716:Maml1 UTSW 11 50257867 missense probably benign 0.01
R4816:Maml1 UTSW 11 50258335 missense possibly damaging 0.68
R5338:Maml1 UTSW 11 50266951 missense probably benign 0.11
R5460:Maml1 UTSW 11 50266353 missense probably benign 0.36
R6701:Maml1 UTSW 11 50266682 missense probably damaging 1.00
R7336:Maml1 UTSW 11 50266449 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTGACATTGAGTGCAAACAAGC -3'
(R):5'- GTCCAAACTATAAAATCAGGGAAGC -3'

Sequencing Primer
(F):5'- CAAGCTGAAATGGTGCCTGTTACC -3'
(R):5'- CAGAGGCTTGGAGTTACAAAAG -3'
Posted On2015-04-17