Mutagenetix > Incidental Mutations

Incidental Mutation 'R3913:Son'

309532

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

040911-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R3913 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91647506-91679221 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 91660111 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

Predicted Effect

unknown
Transcript: ENSMUST00000114036
AA Change: K1915N

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: K1915N

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000114037
AA Change: K1915N

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: K1915N

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000117633
AA Change: K1915N

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: K1915N

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000119368
AA Change: K1915N

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: K1915N

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133589

Predicted Effect

unknown
Transcript: ENSMUST00000140312
AA Change: K1915N

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: K1915N

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000147891
AA Change: K56N

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961
AA Change: K56N

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
Adh7	T	A	3: 138,221,780	V29E	probably damaging	Het
Adra1d	T	A	2: 131,562,155	D5V	probably damaging	Het
Arid1b	A	G	17: 5,342,257	I2021V	possibly damaging	Het
Birc6	A	T	17: 74,573,613	R462*	probably null	Het
Cchcr1	T	C	17: 35,525,336	V341A	probably damaging	Het
Crybg1	T	C	10: 43,998,763	D783G	possibly damaging	Het
Dcaf15	T	C	8: 84,099,165	Y271C	probably damaging	Het
Dcun1d2	A	C	8: 13,281,082	M16R	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Dnttip2	T	C	3: 122,275,391	V85A	possibly damaging	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Exoc7	T	C	11: 116,306,905	D27G	probably benign	Het
Gdpd5	A	G	7: 99,438,339	D70G	probably null	Het
Glyr1	A	G	16: 5,031,913	F199L	probably damaging	Het
Golga4	T	A	9: 118,538,971	M414K	probably damaging	Het
Gpr132	C	A	12: 112,853,020	W62L	probably benign	Het
Gpr179	A	T	11: 97,334,765	V2188E	probably benign	Het
Ilf3	C	T	9: 21,398,126	A526V	possibly damaging	Het
Ints10	T	A	8: 68,813,620	S478T	probably damaging	Het
Kcnab2	A	G	4: 152,395,232	V187A	probably damaging	Het
Kcnj15	C	T	16: 95,296,470	T317I	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl30	T	C	1: 91,359,444	V484A	possibly damaging	Het
Krt90	G	A	15: 101,562,783	R15W	probably damaging	Het
Liph	G	T	16: 21,962,259		probably benign	Het
Lrrc7	G	A	3: 158,291,952	L158F	probably damaging	Het
Maml1	T	C	11: 50,263,432	T602A	probably benign	Het
Mast4	A	G	13: 102,758,669	L782P	probably damaging	Het
Mei4	A	G	9: 81,890,263	K43R	probably benign	Het
Mettl4	A	G	17: 94,740,532	V227A	probably benign	Het
Mst1r	G	A	9: 107,914,746	R827Q	probably benign	Het
Olfm1	A	G	2: 28,208,174	T83A	possibly damaging	Het
Olfr1022	T	C	2: 85,868,771	Y60H	probably damaging	Het
Olfr390	G	T	11: 73,787,696	G253W	probably damaging	Het
Parp4	A	G	14: 56,620,518	E869G	probably damaging	Het
Pate4	C	A	9: 35,611,844	M1I	probably null	Het
Patj	A	G	4: 98,569,101	D1280G	probably damaging	Het
Ppargc1b	T	C	18: 61,311,376	S255G	probably damaging	Het
Rev3l	A	G	10: 39,820,556	I521M	probably damaging	Het
Rlim	T	C	X: 103,962,661	T545A	probably benign	Het
Robo2	A	T	16: 74,035,005	D262E	probably damaging	Het
Sec14l5	A	G	16: 5,147,856		probably benign	Het
Sema4b	A	G	7: 80,220,474	S467G	probably benign	Het
Setd2	C	T	9: 110,551,046	R1310C	probably damaging	Het
Sh3d19	T	C	3: 86,084,776	I37T	probably damaging	Het
Slc23a3	T	A	1: 75,128,922	I422F	probably benign	Het
Snap91	T	C	9: 86,792,557	T534A	possibly damaging	Het
Tnks	A	T	8: 34,873,074	S463R	probably damaging	Het
Tubb3	A	G	8: 123,421,009	H227R	possibly damaging	Het
Tyw1	T	A	5: 130,259,035	V36D	probably damaging	Het
Vwa5a	T	C	9: 38,734,743	I469T	probably damaging	Het
Zdhhc8	A	G	16: 18,226,723	L311P	possibly damaging	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91664322	missense	probably damaging	0.99
IGL01024:Son	APN	16	91655910	missense	probably damaging	1.00
IGL01066:Son	APN	16	91660136	intron	probably benign
IGL01083:Son	APN	16	91657391	missense	probably damaging	1.00
IGL01115:Son	APN	16	91659458	missense	probably benign	0.31
IGL01467:Son	APN	16	91657277	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91657286	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91658015	missense	probably benign	0.00
IGL02156:Son	APN	16	91656104	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91658795	missense	probably damaging	0.99
IGL02498:Son	APN	16	91656825	missense	probably damaging	0.99
IGL02517:Son	APN	16	91655211	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91658471	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91651752	missense	probably damaging	1.00
IGL03180:Son	APN	16	91657008	missense	probably damaging	1.00
R0013:Son	UTSW	16	91651662	missense	probably damaging	1.00
R0036:Son	UTSW	16	91660166	intron	probably benign
R0037:Son	UTSW	16	91664728	missense	probably damaging	1.00
R0041:Son	UTSW	16	91659333	missense	probably damaging	1.00
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91678155	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91656873	missense	probably damaging	0.99
R0256:Son	UTSW	16	91656584	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91656144	missense	probably damaging	1.00
R0815:Son	UTSW	16	91655484	missense	probably damaging	0.98
R1225:Son	UTSW	16	91657340	missense	probably damaging	1.00
R1255:Son	UTSW	16	91664695	missense	probably damaging	1.00
R1457:Son	UTSW	16	91657086	missense	probably damaging	1.00
R1459:Son	UTSW	16	91655342	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91659734	missense	probably damaging	0.99
R1587:Son	UTSW	16	91659718	missense	probably damaging	1.00
R1605:Son	UTSW	16	91657664	missense	probably damaging	1.00
R1629:Son	UTSW	16	91657622	missense	probably damaging	1.00
R1711:Son	UTSW	16	91660226	intron	probably benign
R2138:Son	UTSW	16	91659372	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91647960	splice site	probably null
R2351:Son	UTSW	16	91657659	missense	probably damaging	0.98
R2434:Son	UTSW	16	91654687	missense	probably damaging	1.00
R2870:Son	UTSW	16	91664317	splice site	probably null
R2871:Son	UTSW	16	91664317	splice site	probably null
R2872:Son	UTSW	16	91664317	splice site	probably null
R2889:Son	UTSW	16	91659899	unclassified	probably benign
R3712:Son	UTSW	16	91656726	missense	probably damaging	0.99
R4172:Son	UTSW	16	91659362	missense	probably damaging	1.00
R4301:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91658868	missense	probably damaging	0.96
R4881:Son	UTSW	16	91675509	missense	probably benign	0.31
R5020:Son	UTSW	16	91656375	missense	probably damaging	1.00
R5032:Son	UTSW	16	91657664	missense	probably damaging	1.00
R5151:Son	UTSW	16	91655699	missense	probably damaging	1.00
R5153:Son	UTSW	16	91655022	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91656675	missense	probably damaging	0.99
R5243:Son	UTSW	16	91654733	missense	probably damaging	1.00
R5354:Son	UTSW	16	91655739	missense	probably damaging	0.99
R5529:Son	UTSW	16	91655466	missense	probably damaging	1.00
R5696:Son	UTSW	16	91671413	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91657490	missense	probably damaging	1.00
R5766:Son	UTSW	16	91664987	intron	probably benign
R5788:Son	UTSW	16	91660052	intron	probably benign
R5992:Son	UTSW	16	91658904	missense	probably benign	0.04
R6314:Son	UTSW	16	91660410	intron	probably benign
R6371:Son	UTSW	16	91674741
R6429:Son	UTSW	16	91658166	missense	probably benign	0.33
R6451:Son	UTSW	16	91657602	missense	probably damaging	0.99
R6489:Son	UTSW	16	91655156	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91659947	intron	probably benign
R6753:Son	UTSW	16	91657188	missense	probably damaging	0.99
R6916:Son	UTSW	16	91654785	missense	probably damaging	0.97
R7070:Son	UTSW	16	91656841	unclassified	probably benign
R7079:Son	UTSW	16	91656841	unclassified	probably benign
R7110:Son	UTSW	16	91656518	missense	probably benign	0.01
R7120:Son	UTSW	16	91656691	unclassified	probably benign
R7120:Son	UTSW	16	91670526	missense	unknown
R7167:Son	UTSW	16	91660334	small deletion	probably benign
R7205:Son	UTSW	16	91660295	small deletion	probably benign
R7208:Son	UTSW	16	91662102	missense	unknown
R7219:Son	UTSW	16	91665001	missense	unknown
R7249:Son	UTSW	16	91660334	small deletion	probably benign
R7328:Son	UTSW	16	91658390	missense	probably benign	0.33
R7330:Son	UTSW	16	91656598	unclassified	probably benign
R7374:Son	UTSW	16	91660334	small deletion	probably benign
R7405:Son	UTSW	16	91656691	unclassified	probably benign
R7420:Son	UTSW	16	91660334	small deletion	probably benign
R7424:Son	UTSW	16	91660334	small deletion	probably benign
R7464:Son	UTSW	16	91656691	unclassified	probably benign
R7514:Son	UTSW	16	91654860	missense	probably damaging	0.99
R7555:Son	UTSW	16	91658922	missense	probably damaging	0.99
R7645:Son	UTSW	16	91660295	small deletion	probably benign
R7716:Son	UTSW	16	91656691	unclassified	probably benign
R7718:Son	UTSW	16	91660334	small deletion	probably benign
R7778:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7824:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7856:Son	UTSW	16	91659258	missense	probably damaging	0.99
R7870:Son	UTSW	16	91656598	unclassified	probably benign
R7928:Son	UTSW	16	91656841	unclassified	probably benign
R7972:Son	UTSW	16	91660334	small deletion	probably benign
R7978:Son	UTSW	16	91660334	small deletion	probably benign
R8000:Son	UTSW	16	91660334	small deletion	probably benign
R8192:Son	UTSW	16	91655549	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8227:Son	UTSW	16	91656691	unclassified	probably benign
R8233:Son	UTSW	16	91660334	small deletion	probably benign
R8255:Son	UTSW	16	91664936	missense	unknown
R8292:Son	UTSW	16	91656657	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91660334	small deletion	probably benign
R8468:Son	UTSW	16	91656691	unclassified	probably benign
R8495:Son	UTSW	16	91660295	small deletion	probably benign
RF007:Son	UTSW	16	91659369	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91656691	unclassified	probably benign
Z1176:Son	UTSW	16	91655801	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- ACTCTTCATTACGGTCTCGGAG -3'
(R):5'- GGGAAATGCTAAAACTTCTCCTTC -3'

Sequencing Primer
(F):5'- CGGAGTAAGCGTTCCAAGTCTTC -3'
(R):5'- TTCTACCAACAGATCTAGACCGTCTC -3'

Posted On

2015-04-17