Incidental Mutation 'R3914:G530012D18Rik'
ID309543
Institutional Source Beutler Lab
Gene Symbol G530012D18Rik
Ensembl Gene ENSMUSG00000094127
Gene NameRIKEN cDNA G530012D1 gene
Synonyms
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R3914 (G1)
Quality Score175
Status Validated
Chromosome1
Chromosomal Location85575676-85577295 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGAGAGA to CAGAGAGAGA at 85577224 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect probably null
Transcript: ENSMUST00000178024
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in G530012D18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB001:G530012D18Rik UTSW 1 85577214 missense unknown
BB003:G530012D18Rik UTSW 1 85577214 missense unknown
BB005:G530012D18Rik UTSW 1 85577214 missense unknown
BB006:G530012D18Rik UTSW 1 85577214 missense unknown
BB011:G530012D18Rik UTSW 1 85577214 missense unknown
BB013:G530012D18Rik UTSW 1 85577214 missense unknown
BB015:G530012D18Rik UTSW 1 85577214 missense unknown
BB016:G530012D18Rik UTSW 1 85577214 missense unknown
FR4340:G530012D18Rik UTSW 1 85577152 small deletion probably benign
FR4449:G530012D18Rik UTSW 1 85577180 small deletion probably benign
FR4737:G530012D18Rik UTSW 1 85577178 frame shift probably null
IGL03050:G530012D18Rik UTSW 1 85577224 frame shift probably null
PIT4142001:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R0707:G530012D18Rik UTSW 1 85577224 frame shift probably null
R0730:G530012D18Rik UTSW 1 85577036 utr 3 prime probably benign
R0819:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1053:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1155:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1236:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1245:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1880:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1961:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2033:G530012D18Rik UTSW 1 85577154 frame shift probably null
R2055:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2510:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R2903:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2989:G530012D18Rik UTSW 1 85577216 frame shift probably null
R3000:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3757:G530012D18Rik UTSW 1 85577224 frame shift probably null
R4358:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4407:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4417:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R5086:G530012D18Rik UTSW 1 85577220 utr 3 prime probably benign
R5389:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R7212:G530012D18Rik UTSW 1 85577143 missense unknown
R7823:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R7924:G530012D18Rik UTSW 1 85577214 missense unknown
R7926:G530012D18Rik UTSW 1 85577214 missense unknown
R7927:G530012D18Rik UTSW 1 85577214 missense unknown
R7928:G530012D18Rik UTSW 1 85577214 missense unknown
R7929:G530012D18Rik UTSW 1 85577214 missense unknown
R8162:G530012D18Rik UTSW 1 85577214 missense unknown
R8163:G530012D18Rik UTSW 1 85577214 missense unknown
R8164:G530012D18Rik UTSW 1 85577214 missense unknown
R8263:G530012D18Rik UTSW 1 85577214 missense unknown
R8264:G530012D18Rik UTSW 1 85577214 missense unknown
R8265:G530012D18Rik UTSW 1 85577214 missense unknown
R8491:G530012D18Rik UTSW 1 85577214 missense unknown
R8492:G530012D18Rik UTSW 1 85577214 missense unknown
R8524:G530012D18Rik UTSW 1 85577214 missense unknown
R8744:G530012D18Rik UTSW 1 85577214 missense unknown
X0023:G530012D18Rik UTSW 1 85577224 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACATCGTGAGCGTGTACCAC -3'
(R):5'- GATACAGGTGTTTCCTAAAGGGG -3'

Sequencing Primer
(F):5'- TGTACCACAGTGCTGGGTCAG -3'
(R):5'- GGGGGAAACATCAATATTCACAAG -3'
Posted On2015-04-17