Incidental Mutation 'R3914:Disp1'
ID309544
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Namedispatched RND transporter family member 1
Synonyms1190008H24Rik, DispA
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location183086266-183221522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 183089102 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 585 (F585L)
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
Predicted Effect probably benign
Transcript: ENSMUST00000003035
AA Change: F585L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: F585L

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171366
AA Change: F585L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: F585L

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195372
AA Change: F585L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: F585L

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1120:Disp1 UTSW 1 183098575 missense probably benign 0.24
R1482:Disp1 UTSW 1 183086474 missense possibly damaging 0.61
R1655:Disp1 UTSW 1 183087004 missense probably benign 0.01
R1660:Disp1 UTSW 1 183087742 missense probably damaging 1.00
R1816:Disp1 UTSW 1 183098575 missense probably damaging 0.99
R1835:Disp1 UTSW 1 183089000 missense probably damaging 1.00
R1954:Disp1 UTSW 1 183088543 missense probably damaging 0.99
R2025:Disp1 UTSW 1 183088203 missense probably damaging 1.00
R2136:Disp1 UTSW 1 183088378 missense probably damaging 1.00
R2150:Disp1 UTSW 1 183088372 missense probably damaging 1.00
R2207:Disp1 UTSW 1 183088342 missense possibly damaging 0.94
R2392:Disp1 UTSW 1 183087167 missense probably benign
R2831:Disp1 UTSW 1 183089319 small deletion probably benign
R3111:Disp1 UTSW 1 183087523 missense probably damaging 1.00
R3116:Disp1 UTSW 1 183088922 missense probably benign 0.01
R3160:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3161:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3716:Disp1 UTSW 1 183087751 missense probably damaging 1.00
R4061:Disp1 UTSW 1 183087700 missense probably damaging 0.96
R4191:Disp1 UTSW 1 183089173 missense probably damaging 1.00
R4261:Disp1 UTSW 1 183089386 missense probably damaging 1.00
R4272:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4273:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4351:Disp1 UTSW 1 183099978 missense probably benign 0.01
R4672:Disp1 UTSW 1 183098651 critical splice acceptor site probably null
R4764:Disp1 UTSW 1 183088096 missense probably damaging 1.00
R4910:Disp1 UTSW 1 183135463 missense probably damaging 1.00
R5150:Disp1 UTSW 1 183089499 missense probably damaging 0.98
R5502:Disp1 UTSW 1 183087886 missense probably damaging 1.00
R5616:Disp1 UTSW 1 183088349 missense probably benign 0.30
R5699:Disp1 UTSW 1 183088555 nonsense probably null
R5813:Disp1 UTSW 1 183088410 missense probably damaging 1.00
R5820:Disp1 UTSW 1 183135587 missense probably benign 0.00
R6184:Disp1 UTSW 1 183086332 missense probably benign 0.00
R6228:Disp1 UTSW 1 183099025 missense possibly damaging 0.59
R6306:Disp1 UTSW 1 183087148 missense possibly damaging 0.93
R6505:Disp1 UTSW 1 183086512 missense probably benign 0.02
R6925:Disp1 UTSW 1 183086478 missense probably benign
R7016:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7045:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7046:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7047:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7114:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7123:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7124:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7125:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7161:Disp1 UTSW 1 183087625 missense possibly damaging 0.84
R7510:Disp1 UTSW 1 183088411 missense probably damaging 1.00
R7756:Disp1 UTSW 1 183089734 missense probably damaging 1.00
R7800:Disp1 UTSW 1 183098986 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCGTGCAGAACAATCACAG -3'
(R):5'- CACGCTCATGACCATGTTTGC -3'

Sequencing Primer
(F):5'- GACGTAATTCACCAATATGGCGGTC -3'
(R):5'- ATGACCATGTTTGCCATCATCAG -3'
Posted On2015-04-17