Incidental Mutation 'R3914:Ccdc174'
ID309554
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Namecoiled-coil domain containing 174
Synonyms
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91878053-91899843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91899357 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 392 (A392S)
Ref Sequence ENSEMBL: ENSMUSP00000049280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090] [ENSMUST00000205686]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037783
AA Change: A392S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083
AA Change: A392S

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151378
Predicted Effect probably benign
Transcript: ENSMUST00000205686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205974
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91880362 critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91898282 missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91899557 missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91890853 missense probably benign
R0482:Ccdc174 UTSW 6 91895266 missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91890892 splice site probably benign
R0801:Ccdc174 UTSW 6 91895332 missense possibly damaging 0.72
R1124:Ccdc174 UTSW 6 91899580 missense probably benign 0.33
R1237:Ccdc174 UTSW 6 91890787 splice site probably benign
R1388:Ccdc174 UTSW 6 91881244 splice site probably null
R2176:Ccdc174 UTSW 6 91888089 missense probably benign 0.01
R4342:Ccdc174 UTSW 6 91885356 nonsense probably null
R4775:Ccdc174 UTSW 6 91890894 splice site probably null
R4880:Ccdc174 UTSW 6 91899591 unclassified probably benign
R5579:Ccdc174 UTSW 6 91881350 splice site probably null
R5787:Ccdc174 UTSW 6 91881310 nonsense probably null
R5869:Ccdc174 UTSW 6 91885418 utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91880291 missense probably damaging 1.00
RF008:Ccdc174 UTSW 6 91899366 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGCTACTCCATTTCTTAGCTG -3'
(R):5'- AAAGTGACTGTGGGCGCTTG -3'

Sequencing Primer
(F):5'- TCCTTGTTCTTAGATAATCTGTCGTG -3'
(R):5'- GTGGTGAGCTTTCAGAGGCAG -3'
Posted On2015-04-17