Incidental Mutation 'R3914:Hps5'
ID309557
Institutional Source Beutler Lab
Gene Symbol Hps5
Ensembl Gene ENSMUSG00000014418
Gene NameHPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonymsru-2, ru2, ruby eye 2
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46760466-46796064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46783526 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 257 (T257A)
Ref Sequence ENSEMBL: ENSMUSP00000122887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014562] [ENSMUST00000107653] [ENSMUST00000107654] [ENSMUST00000123725] [ENSMUST00000142663] [ENSMUST00000152759] [ENSMUST00000211347]
Predicted Effect probably damaging
Transcript: ENSMUST00000014562
AA Change: T257A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014562
Gene: ENSMUSG00000014418
AA Change: T257A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107653
AA Change: T257A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418
AA Change: T257A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 6e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 396 416 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 956 965 N/A INTRINSIC
low complexity region 988 1000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107654
AA Change: T257A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418
AA Change: T257A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123725
SMART Domains Protein: ENSMUSP00000116770
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1tbga_ 24 107 5e-4 SMART
Blast:WD40 63 103 1e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000142663
AA Change: T257A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122887
Gene: ENSMUSG00000014418
AA Change: T257A

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 8e-8 SMART
Blast:WD40 63 103 9e-20 BLAST
Blast:WD40 111 151 2e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145776
Predicted Effect probably benign
Transcript: ENSMUST00000152759
SMART Domains Protein: ENSMUSP00000115786
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 2e-8 SMART
Blast:WD40 63 103 1e-21 BLAST
Blast:WD40 111 151 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000211347
Predicted Effect probably benign
Transcript: ENSMUST00000211471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211528
Meta Mutation Damage Score 0.8728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Hps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hps5 APN 7 46775938 missense probably damaging 1.00
IGL00543:Hps5 APN 7 46778073 missense probably benign 0.37
IGL01090:Hps5 APN 7 46788327 missense probably benign 0.02
IGL01351:Hps5 APN 7 46761432 missense probably damaging 1.00
IGL01479:Hps5 APN 7 46762942 critical splice donor site probably null
IGL02056:Hps5 APN 7 46788182 missense probably damaging 1.00
IGL02117:Hps5 APN 7 46783516 missense probably damaging 1.00
IGL02210:Hps5 APN 7 46786570 missense probably benign 0.03
IGL02967:Hps5 APN 7 46769380 missense possibly damaging 0.69
IGL03046:Hps5 APN 7 46777039 splice site probably benign
IGL03187:Hps5 APN 7 46773207 missense probably damaging 1.00
IGL03259:Hps5 APN 7 46763102 missense probably damaging 0.99
dorian_gray UTSW 7 46784145 unclassified probably benign
smoky UTSW 7 46769351 nonsense probably null
Titan UTSW 7 46783469 critical splice donor site probably null
toffee UTSW 7 46777075 intron probably benign
wombat UTSW 7 46783634 missense probably damaging 1.00
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0141:Hps5 UTSW 7 46789181 missense probably damaging 1.00
R0383:Hps5 UTSW 7 46769288 splice site probably null
R0402:Hps5 UTSW 7 46790909 splice site probably benign
R0684:Hps5 UTSW 7 46783469 critical splice donor site probably null
R1159:Hps5 UTSW 7 46772554 unclassified probably null
R1938:Hps5 UTSW 7 46773267 missense probably damaging 1.00
R2058:Hps5 UTSW 7 46768051 missense probably damaging 1.00
R3613:Hps5 UTSW 7 46776874 critical splice donor site probably null
R3881:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3882:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R4095:Hps5 UTSW 7 46775794 missense probably benign 0.01
R4457:Hps5 UTSW 7 46783613 missense probably benign 0.00
R4739:Hps5 UTSW 7 46786589 missense probably benign
R4838:Hps5 UTSW 7 46788354 missense probably damaging 1.00
R4934:Hps5 UTSW 7 46769351 nonsense probably null
R5876:Hps5 UTSW 7 46789196 missense probably damaging 1.00
R6056:Hps5 UTSW 7 46767097 missense probably benign 0.00
R6129:Hps5 UTSW 7 46771774 missense probably benign
R6878:Hps5 UTSW 7 46783634 missense probably damaging 1.00
X0021:Hps5 UTSW 7 46763093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTTGCTTAAGGACTCTCC -3'
(R):5'- GCCATGTTGAATGTGAGTGC -3'

Sequencing Primer
(F):5'- GGACTCTCCTGGTTTCTCTGAATC -3'
(R):5'- CCATGTTGAATGTGAGTGCTTTGAC -3'
Posted On2015-04-17