Mutagenetix > Incidental Mutations

Incidental Mutation 'R3914:Rrm1'

309559

Institutional Source

Beutler Lab

Gene Symbol

Rrm1

Ensembl Gene

ENSMUSG00000030978

Gene Name

ribonucleotide reductase M1

Synonyms

RnrM1

MMRRC Submission

040912-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R3914 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102441695-102469771 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102457174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 300 (Y300C)

Ref Sequence

ENSEMBL: ENSMUSP00000033283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033283]

AlphaFold

P07742

Predicted Effect

probably damaging
Transcript: ENSMUST00000033283
AA Change: Y300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: Y300C

Domain	Start	End	E-Value	Type
Pfam:ATP-cone	1	89	8.7e-21	PFAM
Pfam:Ribonuc_red_lgN	141	213	2.8e-25	PFAM
Pfam:Ribonuc_red_lgC	216	738	1.6e-197	PFAM
coiled coil region	749	778	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209955

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211493

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211786

Meta Mutation Damage Score

0.9387

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	T	A	4: 59,094,201	R174S	possibly damaging	Het
Atp8b2	A	T	3: 89,954,448	I266N	probably damaging	Het
AU041133	G	A	10: 82,151,815	R434Q	probably damaging	Het
Ccdc174	G	T	6: 91,899,357	A392S	possibly damaging	Het
Cdh18	T	C	15: 23,410,685	Y419H	probably damaging	Het
Col20a1	A	G	2: 180,998,492	K509R	probably benign	Het
Csmd2	A	T	4: 128,321,324	D513V	probably benign	Het
D230025D16Rik	A	G	8: 105,239,983	N121D	probably benign	Het
Disp1	A	G	1: 183,089,102	F585L	probably benign	Het
Entpd7	G	A	19: 43,691,158	R50Q	probably benign	Het
Exoc1	G	A	5: 76,543,561	S244N	possibly damaging	Het
Fam234b	A	G	6: 135,225,683	D345G	probably damaging	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gprc6a	T	A	10: 51,628,275	M158L	probably benign	Het
Hdc	T	C	2: 126,603,006	T255A	probably damaging	Het
Hps5	T	C	7: 46,783,526	T257A	probably damaging	Het
Ice1	A	G	13: 70,606,084	C628R	probably benign	Het
Igkv2-137	A	T	6: 67,555,984	R44W	probably damaging	Het
Islr2	A	T	9: 58,198,383	Y531*	probably null	Het
Mast4	G	A	13: 102,739,321	R1112*	probably null	Het
Mrc2	T	C	11: 105,347,232		probably benign	Het
Myo19	G	A	11: 84,894,603	R224H	probably damaging	Het
Nupl1	A	G	14: 60,232,147	M375T	possibly damaging	Het
Phldb2	T	C	16: 45,757,163	E1133G	probably damaging	Het
Rabl6	T	C	2: 25,588,706	T238A	possibly damaging	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Riok3	A	G	18: 12,148,822	I283V	probably benign	Het
Sipa1l3	T	C	7: 29,400,085	D253G	probably benign	Het
Slc22a8	T	A	19: 8,608,186	I305N	probably damaging	Het
Slc26a3	A	T	12: 31,453,906	E303D	probably benign	Het
Slc32a1	C	T	2: 158,611,232		probably benign	Het
Tarsl2	C	A	7: 65,683,808	Q585K	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Ubqlnl	A	G	7: 104,149,606	V228A	probably benign	Het
Wnt7b	T	A	15: 85,537,858	D201V	possibly damaging	Het
Xpot	A	T	10: 121,604,538	I596N	possibly damaging	Het

Other mutations in Rrm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rrm1	APN	7	102454507	nonsense	probably null
IGL01431:Rrm1	APN	7	102457552	splice site	probably benign
IGL03251:Rrm1	APN	7	102457206	missense	probably damaging	1.00
IGL03401:Rrm1	APN	7	102465744	missense	possibly damaging	0.81
Arabica	UTSW	7	102460351	missense	probably damaging	1.00
Pentose	UTSW	7	102460856	splice site	probably null
R0454:Rrm1	UTSW	7	102466926	missense	probably damaging	1.00
R0548:Rrm1	UTSW	7	102467067	critical splice donor site	probably null
R0759:Rrm1	UTSW	7	102457561	missense	probably benign	0.32
R1575:Rrm1	UTSW	7	102456514	missense	probably damaging	1.00
R1586:Rrm1	UTSW	7	102466905	makesense	probably null
R1625:Rrm1	UTSW	7	102468347	missense	probably damaging	0.98
R2207:Rrm1	UTSW	7	102442026	start codon destroyed	probably null	0.98
R2432:Rrm1	UTSW	7	102443072	missense	probably benign	0.03
R2513:Rrm1	UTSW	7	102460689	missense	probably damaging	0.99
R3796:Rrm1	UTSW	7	102465703	splice site	probably null
R4179:Rrm1	UTSW	7	102457198	missense	probably damaging	1.00
R4302:Rrm1	UTSW	7	102447824	missense	probably benign	0.00
R4379:Rrm1	UTSW	7	102446593	missense	probably damaging	1.00
R4416:Rrm1	UTSW	7	102447801	missense	probably benign	0.06
R4690:Rrm1	UTSW	7	102447879	missense	probably benign
R4939:Rrm1	UTSW	7	102466924	missense	probably benign	0.34
R5433:Rrm1	UTSW	7	102465767	missense	probably damaging	0.97
R5445:Rrm1	UTSW	7	102451023	missense	possibly damaging	0.77
R6120:Rrm1	UTSW	7	102460856	splice site	probably null
R6198:Rrm1	UTSW	7	102446729	critical splice donor site	probably null
R6369:Rrm1	UTSW	7	102446702	missense	probably damaging	0.97
R6699:Rrm1	UTSW	7	102460825	missense	probably damaging	1.00
R7009:Rrm1	UTSW	7	102460334	missense	probably damaging	1.00
R7491:Rrm1	UTSW	7	102454557	missense	probably damaging	1.00
R8024:Rrm1	UTSW	7	102457265	missense	probably benign	0.00
R8276:Rrm1	UTSW	7	102460852	critical splice donor site	probably null
R8713:Rrm1	UTSW	7	102460351	missense	probably damaging	1.00
R8963:Rrm1	UTSW	7	102456532	missense	probably benign	0.23
R8968:Rrm1	UTSW	7	102468338	missense	probably benign	0.03
R9028:Rrm1	UTSW	7	102460398	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTAGGAACTAAGTTCTAGAGTTC -3'
(R):5'- GCTTGTAAGAACCAAGCTGAG -3'

Sequencing Primer
(F):5'- CAGCAAGTGGTCTTAACTGC -3'
(R):5'- ACCAAGCTGAGAGGAGCCC -3'

Posted On

2015-04-17