Incidental Mutation 'R3914:Rrm1'
ID309559
Institutional Source Beutler Lab
Gene Symbol Rrm1
Ensembl Gene ENSMUSG00000030978
Gene Nameribonucleotide reductase M1
SynonymsRnrM1
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102441695-102469771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102457174 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 300 (Y300C)
Ref Sequence ENSEMBL: ENSMUSP00000033283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033283]
Predicted Effect probably damaging
Transcript: ENSMUST00000033283
AA Change: Y300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: Y300C

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211786
Meta Mutation Damage Score 0.9387 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Rrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rrm1 APN 7 102454507 nonsense probably null
IGL01431:Rrm1 APN 7 102457552 splice site probably benign
IGL03251:Rrm1 APN 7 102457206 missense probably damaging 1.00
IGL03401:Rrm1 APN 7 102465744 missense possibly damaging 0.81
R0454:Rrm1 UTSW 7 102466926 missense probably damaging 1.00
R0548:Rrm1 UTSW 7 102467067 critical splice donor site probably null
R0759:Rrm1 UTSW 7 102457561 missense probably benign 0.32
R1575:Rrm1 UTSW 7 102456514 missense probably damaging 1.00
R1586:Rrm1 UTSW 7 102466905 makesense probably null
R1625:Rrm1 UTSW 7 102468347 missense probably damaging 0.98
R2207:Rrm1 UTSW 7 102442026 start codon destroyed probably null 0.98
R2432:Rrm1 UTSW 7 102443072 missense probably benign 0.03
R2513:Rrm1 UTSW 7 102460689 missense probably damaging 0.99
R3796:Rrm1 UTSW 7 102465703 splice site probably null
R4179:Rrm1 UTSW 7 102457198 missense probably damaging 1.00
R4302:Rrm1 UTSW 7 102447824 missense probably benign 0.00
R4379:Rrm1 UTSW 7 102446593 missense probably damaging 1.00
R4416:Rrm1 UTSW 7 102447801 missense probably benign 0.06
R4690:Rrm1 UTSW 7 102447879 missense probably benign
R4939:Rrm1 UTSW 7 102466924 missense probably benign 0.34
R5433:Rrm1 UTSW 7 102465767 missense probably damaging 0.97
R5445:Rrm1 UTSW 7 102451023 missense possibly damaging 0.77
R6120:Rrm1 UTSW 7 102460856 splice site probably null
R6198:Rrm1 UTSW 7 102446729 critical splice donor site probably null
R6369:Rrm1 UTSW 7 102446702 missense probably damaging 0.97
R6699:Rrm1 UTSW 7 102460825 missense probably damaging 1.00
R7009:Rrm1 UTSW 7 102460334 missense probably damaging 1.00
R7491:Rrm1 UTSW 7 102454557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAGGAACTAAGTTCTAGAGTTC -3'
(R):5'- GCTTGTAAGAACCAAGCTGAG -3'

Sequencing Primer
(F):5'- CAGCAAGTGGTCTTAACTGC -3'
(R):5'- ACCAAGCTGAGAGGAGCCC -3'
Posted On2015-04-17