Incidental Mutation 'R3914:Gprc6a'
ID309563
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 040912-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51628275 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 158 (M158L)
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: M158L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: M158L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: M158L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: M158L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
Z1177:Gprc6a UTSW 10 51615209 missense not run
Predicted Primers PCR Primer
(F):5'- CCTAATAGCAAATGTGATGGATAGAC -3'
(R):5'- TGACACTTGTACCGAAGTCACA -3'

Sequencing Primer
(F):5'- GGGGAATCATACGGTCTCATACC -3'
(R):5'- TTGTACCGAAGTCACAGCAGC -3'
Posted On2015-04-17