Incidental Mutation 'R0381:F13b'
List |< first << previous [record 7 of 34] next >> last >|
ID30957
Institutional Source Beutler Lab
Gene Symbol F13b
Ensembl Gene ENSMUSG00000026368
Gene Namecoagulation factor XIII, beta subunit
SynonymsCf-13b, Cf13b
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139501702-139523752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139510859 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 334 (K334E)
Ref Sequence ENSEMBL: ENSMUSP00000027615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027615]
Predicted Effect probably damaging
Transcript: ENSMUST00000027615
AA Change: K334E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: K334E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 26 88 1.26e-7 SMART
CCP 92 147 2.11e-9 SMART
CCP 154 209 9.83e-10 SMART
CCP 214 268 7.62e-16 SMART
CCP 275 328 8.62e-15 SMART
CCP 337 390 4.62e-15 SMART
CCP 397 451 3.5e-15 SMART
Blast:CCP 455 516 1e-28 BLAST
CCP 525 579 2.44e-14 SMART
Blast:CCP 583 647 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in F13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:F13b APN 1 139510587 missense probably benign 0.01
IGL00937:F13b APN 1 139517360 splice site probably benign
IGL01138:F13b APN 1 139517212 missense probably damaging 0.99
IGL01319:F13b APN 1 139506793 missense probably damaging 0.98
IGL01328:F13b APN 1 139508082 splice site probably benign
IGL01621:F13b APN 1 139503851 missense probably benign 0.00
IGL01843:F13b APN 1 139516427 missense probably damaging 1.00
IGL02153:F13b APN 1 139516377 missense probably damaging 1.00
IGL02192:F13b APN 1 139517333 missense probably damaging 1.00
IGL02555:F13b APN 1 139517186 missense probably damaging 1.00
IGL03036:F13b APN 1 139508115 missense possibly damaging 0.80
IGL03185:F13b APN 1 139516386 missense probably benign 0.03
IGL03303:F13b APN 1 139513036 missense possibly damaging 0.67
IGL03335:F13b APN 1 139522386 missense probably damaging 1.00
IGL03371:F13b APN 1 139506936 missense probably damaging 1.00
R0139:F13b UTSW 1 139508203 missense probably damaging 0.96
R0157:F13b UTSW 1 139503847 missense probably benign
R0492:F13b UTSW 1 139522559 splice site probably null
R0589:F13b UTSW 1 139506933 missense possibly damaging 0.94
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1515:F13b UTSW 1 139510965 missense probably damaging 1.00
R1869:F13b UTSW 1 139510934 missense probably benign 0.44
R2047:F13b UTSW 1 139508223 missense probably damaging 1.00
R2218:F13b UTSW 1 139506844 missense probably benign 0.42
R2878:F13b UTSW 1 139501747 start codon destroyed probably null
R3032:F13b UTSW 1 139517333 missense probably damaging 1.00
R4077:F13b UTSW 1 139501770 missense unknown
R4079:F13b UTSW 1 139501770 missense unknown
R4208:F13b UTSW 1 139516341 missense probably damaging 1.00
R4350:F13b UTSW 1 139516298 missense probably benign 0.00
R4674:F13b UTSW 1 139501804 missense unknown
R4675:F13b UTSW 1 139501804 missense unknown
R4972:F13b UTSW 1 139510923 missense probably damaging 1.00
R5212:F13b UTSW 1 139512987 missense probably benign
R5343:F13b UTSW 1 139510544 missense possibly damaging 0.61
R5503:F13b UTSW 1 139522543 missense probably benign 0.00
R5984:F13b UTSW 1 139508212 missense probably damaging 1.00
R7012:F13b UTSW 1 139516358 missense probably benign
R7155:F13b UTSW 1 139508157 missense probably damaging 1.00
R7250:F13b UTSW 1 139516489 critical splice donor site probably null
R7478:F13b UTSW 1 139507695 missense probably benign 0.01
R7779:F13b UTSW 1 139516386 missense probably benign 0.03
R7960:F13b UTSW 1 139503771 nonsense probably null
R8007:F13b UTSW 1 139506942 missense probably benign 0.11
R8043:F13b UTSW 1 139522448 missense probably benign
R8281:F13b UTSW 1 139510951 missense probably benign 0.03
Z1088:F13b UTSW 1 139508202 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGCTCTGTGAAAATGGGAAGTGGAC -3'
(R):5'- CATCGGCCACGATTGCAAGTTATC -3'

Sequencing Primer
(F):5'- GTGGACAGAACCTCCAAAATGTATTG -3'
(R):5'- CGATTGCAAGTTATCGTACTTGATCC -3'
Posted On2013-04-24