Incidental Mutation 'R3914:Wnt7b'
ID309574
Institutional Source Beutler Lab
Gene Symbol Wnt7b
Ensembl Gene ENSMUSG00000022382
Gene Namewingless-type MMTV integration site family, member 7B
SynonymsWnt-7b
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85535437-85582473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85537858 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 201 (D201V)
Ref Sequence ENSEMBL: ENSMUSP00000023015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023015] [ENSMUST00000109424] [ENSMUST00000167968] [ENSMUST00000229191] [ENSMUST00000229495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023015
AA Change: D201V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023015
Gene: ENSMUSG00000022382
AA Change: D201V

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
WNT1 40 349 1.29e-214 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109424
AA Change: D194V

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105051
Gene: ENSMUSG00000022382
AA Change: D194V

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
WNT1 44 353 1.29e-214 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167968
AA Change: D127V

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130627
Gene: ENSMUSG00000022382
AA Change: D127V

DomainStartEndE-ValueType
WNT1 1 282 1.21e-182 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229191
AA Change: D198V

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000229495
AA Change: D127V

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1431 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Among members of the human WNT family, this gene product is most similar to WNT7A protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null embryos die at midgestational stages due to placental abnormalities involving the fusion of the chorion and allantois. Mice homozygous for a truncated allele display neonatal lethality, respiratory failure, and lung hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Wnt7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02543:Wnt7b APN 15 85558896 splice site probably benign
R0243:Wnt7b UTSW 15 85558902 critical splice donor site probably null
R0735:Wnt7b UTSW 15 85537495 missense probably damaging 1.00
R0835:Wnt7b UTSW 15 85537777 missense probably damaging 1.00
R1917:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R1919:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R5893:Wnt7b UTSW 15 85581374 intron probably benign
R7483:Wnt7b UTSW 15 85537414 missense possibly damaging 0.95
R7498:Wnt7b UTSW 15 85543679 missense probably damaging 1.00
R7787:Wnt7b UTSW 15 85543911 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTACACCAGGTCCGTCTC -3'
(R):5'- CATTAGGGCTGGATTTAACCAAGTC -3'

Sequencing Primer
(F):5'- GTACACCAGGTCCGTCTCCATAG -3'
(R):5'- AGGGCTGGATTTAACCAAGTCTGATC -3'
Posted On2015-04-17