Incidental Mutation 'R3914:Riok3'
ID309576
Institutional Source Beutler Lab
Gene Symbol Riok3
Ensembl Gene ENSMUSG00000024404
Gene NameRIO kinase 3
SynonymsSudd, 1200013N13Rik, E130306C24Rik, D18Ertd331e
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12128850-12157367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12148822 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 283 (I283V)
Ref Sequence ENSEMBL: ENSMUSP00000025270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025270]
Predicted Effect probably benign
Transcript: ENSMUST00000025270
AA Change: I283V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025270
Gene: ENSMUSG00000024404
AA Change: I283V

DomainStartEndE-ValueType
low complexity region 41 63 N/A INTRINSIC
low complexity region 123 131 N/A INTRINSIC
RIO 222 470 9.88e-141 SMART
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified by the similarity of its product to the Aspergillus nidulans SUDD protein. This gene is now recognized as a member of the right open reading frame (RIO) kinase gene family. This gene encodes a serine/threonine kinase that localizes to the cytoplasm and plays a role in the processing of the pre-40 S ribosomal subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc22a8 T A 19: 8,608,186 I305N probably damaging Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Riok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Riok3 APN 18 12148891 missense possibly damaging 0.81
IGL00229:Riok3 APN 18 12137020 missense probably damaging 1.00
IGL00434:Riok3 APN 18 12148847 missense probably damaging 1.00
IGL01348:Riok3 APN 18 12152963 splice site probably benign
IGL01886:Riok3 APN 18 12139385 missense probably damaging 1.00
IGL02553:Riok3 APN 18 12143016 nonsense probably null
IGL02622:Riok3 APN 18 12142960 missense probably benign 0.24
IGL02718:Riok3 APN 18 12152996 nonsense probably null
LCD18:Riok3 UTSW 18 12129982 intron probably benign
R0240:Riok3 UTSW 18 12155227 missense probably benign 0.37
R0359:Riok3 UTSW 18 12148949 missense probably damaging 1.00
R1505:Riok3 UTSW 18 12152878 missense probably benign 0.06
R1519:Riok3 UTSW 18 12137306 missense probably damaging 1.00
R1698:Riok3 UTSW 18 12128929 missense probably benign 0.02
R1710:Riok3 UTSW 18 12142961 missense probably benign 0.24
R1965:Riok3 UTSW 18 12136962 missense probably damaging 0.99
R2351:Riok3 UTSW 18 12149667 nonsense probably null
R3705:Riok3 UTSW 18 12148954 missense probably benign 0.07
R3956:Riok3 UTSW 18 12142974 nonsense probably null
R4272:Riok3 UTSW 18 12135941 small deletion probably benign
R4273:Riok3 UTSW 18 12135941 small deletion probably benign
R4564:Riok3 UTSW 18 12148879 missense probably damaging 0.99
R4589:Riok3 UTSW 18 12136787 missense probably benign 0.06
R4729:Riok3 UTSW 18 12128927 missense possibly damaging 0.82
R4751:Riok3 UTSW 18 12153983 missense probably benign 0.00
R4938:Riok3 UTSW 18 12155243 missense probably benign 0.06
R4945:Riok3 UTSW 18 12128915 missense probably damaging 0.96
R5449:Riok3 UTSW 18 12155246 missense probably damaging 0.97
R5928:Riok3 UTSW 18 12153018 missense probably benign 0.16
R6220:Riok3 UTSW 18 12149551 missense probably damaging 0.97
R7962:Riok3 UTSW 18 12136719 missense probably benign
R8422:Riok3 UTSW 18 12136812 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGTCAGAGTAGTTTGCTTTAAG -3'
(R):5'- ACCTGCAGCAAGACCATTTTC -3'

Sequencing Primer
(F):5'- GTCTAGGATTCCAGGCCATCCAAG -3'
(R):5'- GCAGCAAGACCATTTTCTTTACC -3'
Posted On2015-04-17