Incidental Mutation 'R3914:Slc22a8'
ID309577
Institutional Source Beutler Lab
Gene Symbol Slc22a8
Ensembl Gene ENSMUSG00000063796
Gene Namesolute carrier family 22 (organic anion transporter), member 8
SynonymsRoct, mOat3, OAT3
MMRRC Submission 040912-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3914 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8591254-8611834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8608186 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 305 (I305N)
Ref Sequence ENSEMBL: ENSMUSP00000131045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010251] [ENSMUST00000170817]
Predicted Effect probably damaging
Transcript: ENSMUST00000010251
AA Change: I305N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010251
Gene: ENSMUSG00000063796
AA Change: I305N

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 73 506 6.8e-33 PFAM
Pfam:MFS_1 97 461 6.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170817
AA Change: I305N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131045
Gene: ENSMUSG00000063796
AA Change: I305N

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 78 507 6.7e-34 PFAM
Pfam:MFS_1 97 461 6.8e-29 PFAM
Meta Mutation Damage Score 0.4289 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased urinary urate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T A 4: 59,094,201 R174S possibly damaging Het
Atp8b2 A T 3: 89,954,448 I266N probably damaging Het
AU041133 G A 10: 82,151,815 R434Q probably damaging Het
Ccdc174 G T 6: 91,899,357 A392S possibly damaging Het
Cdh18 T C 15: 23,410,685 Y419H probably damaging Het
Col20a1 A G 2: 180,998,492 K509R probably benign Het
Csmd2 A T 4: 128,321,324 D513V probably benign Het
D230025D16Rik A G 8: 105,239,983 N121D probably benign Het
Disp1 A G 1: 183,089,102 F585L probably benign Het
Entpd7 G A 19: 43,691,158 R50Q probably benign Het
Exoc1 G A 5: 76,543,561 S244N possibly damaging Het
Fam234b A G 6: 135,225,683 D345G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gprc6a T A 10: 51,628,275 M158L probably benign Het
Hdc T C 2: 126,603,006 T255A probably damaging Het
Hps5 T C 7: 46,783,526 T257A probably damaging Het
Ice1 A G 13: 70,606,084 C628R probably benign Het
Igkv2-137 A T 6: 67,555,984 R44W probably damaging Het
Islr2 A T 9: 58,198,383 Y531* probably null Het
Mast4 G A 13: 102,739,321 R1112* probably null Het
Mrc2 T C 11: 105,347,232 probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Nupl1 A G 14: 60,232,147 M375T possibly damaging Het
Phldb2 T C 16: 45,757,163 E1133G probably damaging Het
Rabl6 T C 2: 25,588,706 T238A possibly damaging Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Riok3 A G 18: 12,148,822 I283V probably benign Het
Rrm1 A G 7: 102,457,174 Y300C probably damaging Het
Sipa1l3 T C 7: 29,400,085 D253G probably benign Het
Slc26a3 A T 12: 31,453,906 E303D probably benign Het
Slc32a1 C T 2: 158,611,232 probably benign Het
Tarsl2 C A 7: 65,683,808 Q585K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubqlnl A G 7: 104,149,606 V228A probably benign Het
Wnt7b T A 15: 85,537,858 D201V possibly damaging Het
Xpot A T 10: 121,604,538 I596N possibly damaging Het
Other mutations in Slc22a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Slc22a8 APN 19 8594135 missense probably benign 0.37
IGL00679:Slc22a8 APN 19 8604855 missense possibly damaging 0.54
IGL00717:Slc22a8 APN 19 8609929 missense probably benign 0.02
IGL00974:Slc22a8 APN 19 8609926 missense probably damaging 1.00
IGL01104:Slc22a8 APN 19 8607965 missense possibly damaging 0.62
IGL01975:Slc22a8 APN 19 8605411 missense probably damaging 0.96
IGL02025:Slc22a8 APN 19 8594175 missense possibly damaging 0.65
IGL02353:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02360:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02535:Slc22a8 APN 19 8610203 missense probably benign
IGL02639:Slc22a8 APN 19 8593959 missense probably benign
IGL03167:Slc22a8 APN 19 8609958 missense probably damaging 1.00
IGL03368:Slc22a8 APN 19 8609119 splice site probably benign
R0333:Slc22a8 UTSW 19 8608150 splice site probably benign
R1290:Slc22a8 UTSW 19 8609911 missense probably damaging 1.00
R1773:Slc22a8 UTSW 19 8594229 missense probably damaging 1.00
R1861:Slc22a8 UTSW 19 8606139 missense probably damaging 1.00
R2516:Slc22a8 UTSW 19 8610195 missense probably benign
R2988:Slc22a8 UTSW 19 8610248 missense probably benign 0.00
R4206:Slc22a8 UTSW 19 8608233 missense probably benign 0.00
R5092:Slc22a8 UTSW 19 8594164 missense probably damaging 1.00
R5463:Slc22a8 UTSW 19 8609274 missense probably benign 0.00
R5470:Slc22a8 UTSW 19 8607870 missense probably damaging 1.00
R6733:Slc22a8 UTSW 19 8609292 missense probably benign 0.01
R7009:Slc22a8 UTSW 19 8605417 missense probably benign 0.05
R7642:Slc22a8 UTSW 19 8610045 missense probably benign 0.00
R7684:Slc22a8 UTSW 19 8609930 missense probably benign 0.00
R7689:Slc22a8 UTSW 19 8607884 missense probably damaging 0.96
R7729:Slc22a8 UTSW 19 8593959 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAACCATGTATCTGCCTCTCTTG -3'
(R):5'- ATGGAAGCTGGCCTTAGCAG -3'

Sequencing Primer
(F):5'- GCCTGTTTCCTTGGCTTAGAGC -3'
(R):5'- AGCCCTAGGAGGCATTCTCTTG -3'
Posted On2015-04-17