Incidental Mutation 'R3915:AA986860'
ID309579
Institutional Source Beutler Lab
Gene Symbol AA986860
Ensembl Gene ENSMUSG00000042510
Gene Nameexpressed sequence AA986860
Synonyms
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130731976-130744622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130742607 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 189 (K189E)
Ref Sequence ENSEMBL: ENSMUSP00000046172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039323]
Predicted Effect probably benign
Transcript: ENSMUST00000039323
AA Change: K189E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510
AA Change: K189E

DomainStartEndE-ValueType
Pfam:SARG 33 606 1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190859
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in AA986860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:AA986860 APN 1 130742836 missense possibly damaging 0.69
IGL01761:AA986860 APN 1 130742722 missense possibly damaging 0.70
IGL02557:AA986860 APN 1 130742707 missense probably benign 0.02
IGL03003:AA986860 APN 1 130743772 missense probably damaging 1.00
IGL02802:AA986860 UTSW 1 130743393 missense probably benign 0.00
R0326:AA986860 UTSW 1 130742898 missense possibly damaging 0.87
R0483:AA986860 UTSW 1 130743825 missense probably damaging 1.00
R0906:AA986860 UTSW 1 130737693 splice site probably benign
R0932:AA986860 UTSW 1 130737693 splice site probably null
R1522:AA986860 UTSW 1 130743094 missense probably damaging 1.00
R1762:AA986860 UTSW 1 130737688 critical splice donor site probably null
R1874:AA986860 UTSW 1 130742691 missense probably benign 0.06
R2083:AA986860 UTSW 1 130741069 missense probably damaging 1.00
R2091:AA986860 UTSW 1 130743169 missense probably benign 0.01
R2093:AA986860 UTSW 1 130743304 missense probably benign 0.13
R3546:AA986860 UTSW 1 130741189 splice site probably benign
R4679:AA986860 UTSW 1 130742403 missense possibly damaging 0.67
R4703:AA986860 UTSW 1 130743355 missense probably benign 0.19
R4890:AA986860 UTSW 1 130740988 splice site probably benign
R4988:AA986860 UTSW 1 130742710 missense probably damaging 1.00
R5171:AA986860 UTSW 1 130742847 missense probably benign 0.23
R5327:AA986860 UTSW 1 130741003 missense probably damaging 1.00
R5424:AA986860 UTSW 1 130742941 missense probably damaging 1.00
R5763:AA986860 UTSW 1 130743031 missense possibly damaging 0.53
R5799:AA986860 UTSW 1 130741171 nonsense probably null
R6247:AA986860 UTSW 1 130743043 missense possibly damaging 0.78
R7124:AA986860 UTSW 1 130742887 missense possibly damaging 0.67
R7747:AA986860 UTSW 1 130743547 missense possibly damaging 0.60
Z1176:AA986860 UTSW 1 130742991 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTCCTCCTGAGTCTCACAG -3'
(R):5'- ATGGGATACGGTTTCAGAAGAC -3'

Sequencing Primer
(F):5'- TCTCAGGGCTGGTTCCTACAG -3'
(R):5'- GGGATACGGTTTCAGAAGACATTTCC -3'
Posted On2015-04-17