Incidental Mutation 'R3915:Slc30a10'
ID309580
Institutional Source Beutler Lab
Gene Symbol Slc30a10
Ensembl Gene ENSMUSG00000026614
Gene Namesolute carrier family 30, member 10
Synonyms
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3915 (G1)
Quality Score205
Status Validated
Chromosome1
Chromosomal Location185454848-185468762 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 185455136 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 25 (E25*)
Ref Sequence ENSEMBL: ENSMUSP00000053181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061093]
Predicted Effect probably null
Transcript: ENSMUST00000061093
AA Change: E25*
SMART Domains Protein: ENSMUSP00000053181
Gene: ENSMUSG00000026614
AA Change: E25*

DomainStartEndE-ValueType
Pfam:Cation_efflux 11 299 2e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180623
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly expressed in the liver and is inducible by manganese. Its protein product appears to be critical in maintaining manganese levels, and has higher specificity for manganese than zinc. Loss of function mutations appear to result in a pleomorphic phenotype, including dystonia and adult-onset parkinsonism. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit post-weaning growth defects, increased manganese levels in the brain, blood, liver and thyroid gland, severe hypothyroidism and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Slc30a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Slc30a10 APN 1 185455419 missense probably damaging 1.00
IGL01779:Slc30a10 APN 1 185464179 missense possibly damaging 0.94
IGL01906:Slc30a10 APN 1 185456396 nonsense probably null
IGL02024:Slc30a10 APN 1 185455241 missense possibly damaging 0.94
R0111:Slc30a10 UTSW 1 185455547 missense probably benign
R0133:Slc30a10 UTSW 1 185455173 missense probably damaging 1.00
R1886:Slc30a10 UTSW 1 185462864 missense probably damaging 1.00
R5597:Slc30a10 UTSW 1 185462700 missense probably damaging 1.00
R6175:Slc30a10 UTSW 1 185455311 missense probably damaging 1.00
R6669:Slc30a10 UTSW 1 185464428 missense probably benign
R8108:Slc30a10 UTSW 1 185464154 missense possibly damaging 0.90
R8345:Slc30a10 UTSW 1 185455467 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CAGCCAAATCAAGCTTGGG -3'
(R):5'- AGGAAGACTGCGTTGCTGAG -3'

Sequencing Primer
(F):5'- AGGTGGCCTTTGCGACTC -3'
(R):5'- TAGCCGTAGGTGGCACTGG -3'
Posted On2015-04-17