Mutagenetix > Incidental Mutation

Incidental Mutation 'R3915:Clasp2'

309599

Institutional Source

Beutler Lab

Gene Symbol

Clasp2

Ensembl Gene

ENSMUSG00000033392

Gene Name

CLIP associating protein 2

Synonyms

1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik

MMRRC Submission

040913-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113741473-113919682 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 113908737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 374 (S374A)

Ref Sequence

ENSEMBL: ENSMUSP00000150145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111838
AA Change: S1060A

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: S1060A

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	562	572	N/A	INTRINSIC
low complexity region	614	634	N/A	INTRINSIC
TOG	640	877	2.03e-1	SMART
low complexity region	995	1009	N/A	INTRINSIC
TOG	1043	1274	1.49e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163895
AA Change: S1081A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: S1081A

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	583	593	N/A	INTRINSIC
low complexity region	635	655	N/A	INTRINSIC
TOG	661	898	2.03e-1	SMART
low complexity region	1016	1030	N/A	INTRINSIC
TOG	1064	1295	1.49e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166734
AA Change: S1061A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: S1061A

Domain	Start	End	E-Value	Type
TOG	90	323	1.17e-8	SMART
low complexity region	382	395	N/A	INTRINSIC
low complexity region	459	472	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	562	572	N/A	INTRINSIC
low complexity region	614	634	N/A	INTRINSIC
TOG	640	878	7.51e-1	SMART
low complexity region	996	1010	N/A	INTRINSIC
TOG	1044	1275	1.49e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000213663
AA Change: S374A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214522
AA Change: S1078A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000215022

Meta Mutation Damage Score

0.2072

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

98% (43/44)

MGI Phenotype

PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	G	A	5: 3,577,248	V75I	possibly damaging	Het
AA986860	A	G	1: 130,742,607	K189E	probably benign	Het
Abcf1	C	T	17: 35,959,510	R596H	possibly damaging	Het
Axl	T	C	7: 25,760,744		probably benign	Het
Birc6	A	G	17: 74,579,608	K644E	probably benign	Het
Btbd11	C	A	10: 85,632,270	H810N	probably damaging	Het
Btnl7-ps	T	A	17: 34,541,515		noncoding transcript	Het
Car8	A	T	4: 8,184,576		probably benign	Het
Ccdc62	C	T	5: 123,954,715	R588C	probably damaging	Het
Ctnnb1	A	G	9: 120,955,651	H503R	probably benign	Het
Cwf19l2	A	G	9: 3,456,776	H703R	probably damaging	Het
Efcab7	A	T	4: 99,878,173	Q133L	probably damaging	Het
Ehmt2	T	C	17: 34,903,467	S280P	probably damaging	Het
Eomes	A	G	9: 118,481,273	M351V	probably benign	Het
Ets2	G	A	16: 95,718,993	R421H	probably damaging	Het
Fam222b	C	G	11: 78,154,930	P439R	probably benign	Het
Gbp11	T	A	5: 105,331,112	K153N	probably damaging	Het
Gm8989	A	G	7: 106,330,238	S151P	probably benign	Het
Gm8994	A	T	6: 136,329,422	T294S	probably benign	Het
Golim4	T	C	3: 75,903,327	T174A	probably damaging	Het
Grid1	A	G	14: 35,520,727	Y679C	probably damaging	Het
Ikzf3	T	C	11: 98,490,586	D56G	probably damaging	Het
Kcnj16	A	G	11: 111,025,556	D348G	probably benign	Het
Kidins220	T	C	12: 25,053,958	L1319P	possibly damaging	Het
Lrp1b	T	A	2: 41,449,236	D751V	probably damaging	Het
Macc1	T	C	12: 119,446,816	C440R	probably benign	Het
Mbd2	T	C	18: 70,622,609	V382A	probably benign	Het
Olfr45	T	A	7: 140,690,975	D23E	probably benign	Het
Olfr559	C	T	7: 102,724,202	R96H	possibly damaging	Het
Olfr780	G	A	10: 129,322,309	A229T	probably benign	Het
Pgs1	T	G	11: 118,019,646	S528A	probably benign	Het
Pitpnm3	T	C	11: 72,112,284	T67A	probably damaging	Het
Pnliprp2	T	G	19: 58,760,362	V33G	probably damaging	Het
Ptn	T	C	6: 36,743,347	N90S	probably damaging	Het
Ptprt	A	T	2: 161,555,555		probably benign	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rasgrp1	G	A	2: 117,288,641	S505F	probably damaging	Het
Sesn1	G	A	10: 41,894,890	R139H	probably benign	Het
Slc17a7	T	A	7: 45,168,720	L23Q	probably damaging	Het
Slc30a10	G	T	1: 185,455,136	E25*	probably null	Het
Smco1	A	G	16: 32,273,765	I85V	probably benign	Het
Vmn1r76	A	T	7: 11,930,569	S239R	probably benign	Het
Zc3h7a	A	T	16: 11,156,210	V237D	possibly damaging	Het

Other mutations in Clasp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Clasp2	APN	9	113905992	splice site	probably benign
IGL00885:Clasp2	APN	9	113911416	missense	probably damaging	1.00
IGL01314:Clasp2	APN	9	113906127	missense	possibly damaging	0.89
IGL01344:Clasp2	APN	9	113813292	splice site	probably null
IGL01567:Clasp2	APN	9	113880096	missense	probably damaging	1.00
IGL02238:Clasp2	APN	9	113880020	missense	probably damaging	1.00
IGL02299:Clasp2	APN	9	113879989	missense	probably damaging	1.00
IGL02323:Clasp2	APN	9	113868726	splice site	probably benign
IGL02635:Clasp2	APN	9	113908842	missense	probably damaging	0.98
IGL02645:Clasp2	APN	9	113890061	missense	probably damaging	1.00
IGL02976:Clasp2	APN	9	113906136	missense	probably damaging	1.00
IGL03190:Clasp2	APN	9	113844140	nonsense	probably null
IGL03219:Clasp2	APN	9	113848477	splice site	probably benign
PIT4810001:Clasp2	UTSW	9	113906067	missense	probably damaging	1.00
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0067:Clasp2	UTSW	9	113860141	splice site	probably benign
R0421:Clasp2	UTSW	9	113854302	missense	probably benign	0.02
R0432:Clasp2	UTSW	9	113909419	missense	probably benign	0.00
R0458:Clasp2	UTSW	9	113906224	splice site	probably null
R0865:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R0972:Clasp2	UTSW	9	113847705	missense	possibly damaging	0.58
R1037:Clasp2	UTSW	9	113896634	splice site	probably benign
R1925:Clasp2	UTSW	9	113906197	missense	possibly damaging	0.88
R2015:Clasp2	UTSW	9	113911500	missense	possibly damaging	0.57
R2066:Clasp2	UTSW	9	113906157	missense	possibly damaging	0.86
R2330:Clasp2	UTSW	9	113876304	missense	probably damaging	1.00
R2568:Clasp2	UTSW	9	113878764	missense	probably benign
R3011:Clasp2	UTSW	9	113901513	missense	probably damaging	1.00
R3879:Clasp2	UTSW	9	113889961	missense	probably damaging	0.98
R3928:Clasp2	UTSW	9	113906105	missense	probably benign	0.28
R4323:Clasp2	UTSW	9	113889959	missense	possibly damaging	0.91
R4571:Clasp2	UTSW	9	113847721	missense	probably damaging	1.00
R4975:Clasp2	UTSW	9	113903916	missense	probably damaging	1.00
R5445:Clasp2	UTSW	9	113903946	missense	probably damaging	1.00
R5564:Clasp2	UTSW	9	113812768	critical splice donor site	probably null
R5697:Clasp2	UTSW	9	113860122	missense	probably benign	0.01
R5780:Clasp2	UTSW	9	113850152	missense	probably damaging	0.99
R5787:Clasp2	UTSW	9	113862242	missense	probably damaging	1.00
R6011:Clasp2	UTSW	9	113876247	missense	probably benign	0.07
R6026:Clasp2	UTSW	9	113911578	missense	probably benign	0.13
R6090:Clasp2	UTSW	9	113852735	missense	probably benign	0.06
R6262:Clasp2	UTSW	9	113876352	critical splice donor site	probably null
R6427:Clasp2	UTSW	9	113892444	missense	probably damaging	1.00
R6464:Clasp2	UTSW	9	113773717	missense	probably damaging	1.00
R6586:Clasp2	UTSW	9	113813264	missense	probably damaging	1.00
R6628:Clasp2	UTSW	9	113896720	missense	probably damaging	1.00
R6745:Clasp2	UTSW	9	113875270	nonsense	probably null
R7032:Clasp2	UTSW	9	113854323	missense	probably benign	0.04
R7165:Clasp2	UTSW	9	113786399	splice site	probably null
R7221:Clasp2	UTSW	9	113852757	missense	probably damaging	0.99
R7336:Clasp2	UTSW	9	113876353	splice site	probably null
R7583:Clasp2	UTSW	9	113908687	missense	probably benign	0.02
R7774:Clasp2	UTSW	9	113848736	splice site	probably null
R7895:Clasp2	UTSW	9	113903948	missense	probably benign	0.03
R8084:Clasp2	UTSW	9	113847755	missense	probably benign	0.16
R8109:Clasp2	UTSW	9	113911520	missense	probably damaging	1.00
R8171:Clasp2	UTSW	9	113903906	missense	possibly damaging	0.88
R8230:Clasp2	UTSW	9	113892414	missense	possibly damaging	0.73
R8810:Clasp2	UTSW	9	113899581	missense	probably damaging	1.00
R8879:Clasp2	UTSW	9	113773705	missense	probably benign	0.39
R8888:Clasp2	UTSW	9	113903868	missense	possibly damaging	0.54
R8889:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8892:Clasp2	UTSW	9	113880183	missense	probably damaging	1.00
R8922:Clasp2	UTSW	9	113896660	nonsense	probably null
R9042:Clasp2	UTSW	9	113905997	missense	probably benign
R9195:Clasp2	UTSW	9	113841977	missense	probably benign	0.06
R9355:Clasp2	UTSW	9	113835241	missense	probably damaging	1.00
R9481:Clasp2	UTSW	9	113841601	missense	probably damaging	1.00
R9502:Clasp2	UTSW	9	113908798	missense	probably benign	0.01
R9523:Clasp2	UTSW	9	113876304	missense	probably damaging	0.98
R9525:Clasp2	UTSW	9	113911609	missense	probably damaging	1.00
R9653:Clasp2	UTSW	9	113841925	missense	probably benign	0.01
R9699:Clasp2	UTSW	9	113909546	critical splice donor site	probably null
R9738:Clasp2	UTSW	9	113761597	nonsense	probably null
R9775:Clasp2	UTSW	9	113896672	missense	probably benign
X0022:Clasp2	UTSW	9	113852672	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113770221	missense	probably damaging	1.00
Z1177:Clasp2	UTSW	9	113908795	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGATTCAGGGATGGCAACTG -3'
(R):5'- GGTACAATTCCTAGACCTCCAC -3'

Sequencing Primer
(F):5'- TCAGGGATGGCAACTGAAAATTAATG -3'
(R):5'- CTCAGCATGGCAGAATATAGTTTAC -3'

Posted On

2015-04-17