Incidental Mutation 'R0381:Fnbp1'
List |< first << previous [record 10 of 34] next >> last >|
ID30960
Institutional Source Beutler Lab
Gene Symbol Fnbp1
Ensembl Gene ENSMUSG00000075415
Gene Nameformin binding protein 1
Synonyms2210010H06Rik, FBP17, FBP1, 1110057E06Rik
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R0381 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31026206-31142008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31033029 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 549 (G549D)
Ref Sequence ENSEMBL: ENSMUSP00000109188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073879] [ENSMUST00000075326] [ENSMUST00000100207] [ENSMUST00000100208] [ENSMUST00000113555] [ENSMUST00000113559] [ENSMUST00000113560] [ENSMUST00000113562] [ENSMUST00000113564]
Predicted Effect probably benign
Transcript: ENSMUST00000073879
AA Change: G549D

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109188
Gene: ENSMUSG00000075415
AA Change: G549D

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075326
AA Change: G581D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074796
Gene: ENSMUSG00000075415
AA Change: G581D

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 360 451 1e-26 PDB
low complexity region 503 512 N/A INTRINSIC
SH3 518 575 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100207
AA Change: G554D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000097781
Gene: ENSMUSG00000075415
AA Change: G554D

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 338 424 1e-26 PDB
low complexity region 476 485 N/A INTRINSIC
SH3 491 548 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100208
AA Change: G610D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097782
Gene: ENSMUSG00000075415
AA Change: G610D

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 394 480 2e-26 PDB
low complexity region 532 541 N/A INTRINSIC
SH3 547 604 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113555
AA Change: G586D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109184
Gene: ENSMUSG00000075415
AA Change: G586D

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 370 456 1e-26 PDB
low complexity region 508 517 N/A INTRINSIC
SH3 523 580 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113559
SMART Domains Protein: ENSMUSP00000109189
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
PDB:2EFL|A 1 221 1e-144 PDB
low complexity region 250 262 N/A INTRINSIC
PDB:2KE4|A 300 391 1e-26 PDB
low complexity region 443 452 N/A INTRINSIC
SH3 458 515 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113560
SMART Domains Protein: ENSMUSP00000109190
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 399 485 2e-26 PDB
low complexity region 537 546 N/A INTRINSIC
SH3 552 609 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113562
SMART Domains Protein: ENSMUSP00000109192
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113564
SMART Domains Protein: ENSMUSP00000109194
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 472 481 N/A INTRINSIC
SH3 487 544 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128431
Predicted Effect unknown
Transcript: ENSMUST00000128500
AA Change: G382D
SMART Domains Protein: ENSMUSP00000115013
Gene: ENSMUSG00000075415
AA Change: G382D

DomainStartEndE-ValueType
Pfam:FCH 1 80 7.7e-20 PFAM
PDB:2KE4|A 167 253 2e-27 PDB
low complexity region 305 314 N/A INTRINSIC
SH3 320 377 3.2e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138581
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the formin-binding-protein family. The protein contains an N-terminal Fer/Cdc42-interacting protein 4 (CIP4) homology (FCH) domain followed by a coiled-coil domain, a proline-rich motif, a second coiled-coil domain, a Rho family protein-binding domain (RBD), and a C-terminal SH3 domain. This protein binds sorting nexin 2 (SNX2), tankyrase (TNKS), and dynamin; an interaction between this protein and formin has not been demonstrated yet in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sypl2 T C 3: 108,226,157 E32G possibly damaging Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Fnbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Fnbp1 APN 2 31083042 missense probably damaging 1.00
IGL01640:Fnbp1 APN 2 31105291 missense probably damaging 1.00
R0573:Fnbp1 UTSW 2 31058978 missense probably damaging 1.00
R0713:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1120:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1364:Fnbp1 UTSW 2 31059031 splice site probably benign
R1974:Fnbp1 UTSW 2 31053047 missense probably null 0.94
R3800:Fnbp1 UTSW 2 31033131 missense probably damaging 1.00
R4176:Fnbp1 UTSW 2 31036119 splice site probably null
R4293:Fnbp1 UTSW 2 31105350 missense probably damaging 1.00
R4478:Fnbp1 UTSW 2 31105254 missense probably damaging 1.00
R4602:Fnbp1 UTSW 2 31036540 critical splice donor site probably null
R4716:Fnbp1 UTSW 2 31055520 missense probably benign 0.03
R5909:Fnbp1 UTSW 2 31048199 splice site probably null
R6436:Fnbp1 UTSW 2 31096127 missense probably damaging 1.00
R7075:Fnbp1 UTSW 2 31058914 missense probably benign
R7747:Fnbp1 UTSW 2 31036147 missense probably damaging 0.99
R8069:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
Z1177:Fnbp1 UTSW 2 31083059 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACGTCAGGTTACTCAGTGTGGGC -3'
(R):5'- AGAACGAAGGCACCATTTCCGTAG -3'

Sequencing Primer
(F):5'- taggcacgagccaccac -3'
(R):5'- CACCATTTCCGTAGTTGAAGG -3'
Posted On2013-04-24