Mutagenetix > Incidental Mutation

Incidental Mutation 'R3915:Ctnnb1'

309601

Institutional Source

Beutler Lab

Gene Symbol

Ctnnb1

Ensembl Gene

ENSMUSG00000006932

Gene Name

catenin beta 1

Synonyms

Catnb, beta catenin, beta-catenin, catenin (cadherin associated protein), beta 1

MMRRC Submission

040913-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120762466-120789573 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120784717 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 503 (H503R)

Ref Sequence

ENSEMBL: ENSMUSP00000136294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007130] [ENSMUST00000130845] [ENSMUST00000145093] [ENSMUST00000154356] [ENSMUST00000178812] [ENSMUST00000163844]

AlphaFold

Q02248

Predicted Effect

probably benign
Transcript: ENSMUST00000007130
AA Change: H503R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000007130
Gene: ENSMUSG00000006932
AA Change: H503R

Domain	Start	End	E-Value	Type
ARM	141	180	1.92e1	SMART
ARM	181	223	6.29e-2	SMART
ARM	224	264	1.23e-4	SMART
ARM	265	306	7.34e-3	SMART
ARM	308	349	2.48e0	SMART
ARM	350	390	1.48e-7	SMART
ARM	392	429	3.18e1	SMART
ARM	430	473	1.54e-5	SMART
ARM	478	519	7.34e-3	SMART
ARM	520	582	3.34e-6	SMART
ARM	583	623	2.82e-4	SMART
ARM	624	664	1.78e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126633

Predicted Effect

probably benign
Transcript: ENSMUST00000130845

SMART Domains

Protein: ENSMUSP00000116365
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
PDB:2Z6G\|A	1	80	2e-43	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000133689

SMART Domains

Protein: ENSMUSP00000128564
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
Blast:ARM	2	41	2e-20	BLAST
Pfam:Arm	42	82	4.4e-9	PFAM
Blast:ARM	83	123	9e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139138

Predicted Effect

probably benign
Transcript: ENSMUST00000145093

SMART Domains

Protein: ENSMUSP00000120132
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
PDB:2Z6G\|A	1	174	1e-113	PDB
SCOP:d1gw5a_	90	172	5e-8	SMART
Blast:ARM	141	174	4e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000154356
AA Change: H503R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125763
Gene: ENSMUSG00000006932
AA Change: H503R

Domain	Start	End	E-Value	Type
ARM	141	180	1.92e1	SMART
ARM	181	223	6.29e-2	SMART
ARM	224	264	1.23e-4	SMART
ARM	265	306	7.34e-3	SMART
ARM	308	349	2.48e0	SMART
ARM	350	390	1.48e-7	SMART
ARM	392	429	3.18e1	SMART
ARM	430	473	1.54e-5	SMART
ARM	478	519	7.34e-3	SMART
ARM	520	562	3e1	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000169931
AA Change: H65R

SMART Domains

Protein: ENSMUSP00000128858
Gene: ENSMUSG00000006932
AA Change: H65R

Domain	Start	End	E-Value	Type
ARM	2	36	3.8e1	SMART
ARM	41	82	7.34e-3	SMART
ARM	83	144	1.92e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154687

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156911

Predicted Effect

probably benign
Transcript: ENSMUST00000178812
AA Change: H503R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000136294
Gene: ENSMUSG00000006932
AA Change: H503R

Domain	Start	End	E-Value	Type
ARM	141	180	1.92e1	SMART
ARM	181	223	6.29e-2	SMART
ARM	224	264	1.23e-4	SMART
ARM	265	306	7.34e-3	SMART
ARM	308	349	2.48e0	SMART
ARM	350	390	1.48e-7	SMART
ARM	392	429	3.18e1	SMART
ARM	430	473	1.54e-5	SMART
ARM	478	519	7.34e-3	SMART
ARM	520	582	3.34e-6	SMART
ARM	583	623	2.82e-4	SMART
ARM	624	664	1.78e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198187

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170406

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213408

Predicted Effect

probably benign
Transcript: ENSMUST00000163844

SMART Domains

Protein: ENSMUSP00000126905
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
PDB:2Z6G\|A	1	72	2e-37	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215573

Predicted Effect

probably benign
Transcript: ENSMUST00000170729

SMART Domains

Protein: ENSMUSP00000130471
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
Blast:ARM	2	35	4e-15	BLAST
PDB:3SLA\|E	2	87	1e-57	PDB
SCOP:d1jdha_	2	89	2e-12	SMART
Blast:ARM	36	78	2e-23	BLAST

Meta Mutation Damage Score

0.0681

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: This gene encodes not only an important cytoplasmic component of the classical cadherin adhesion complex that forms the adherens junction in epithelia and mediates cell-cell adhesion in many other tissues but also a key signaling molecule in the canonical Wnt signaling pathway that controls cell growth and differentiation during both normal development and tumorigenesis. The gene product contains a central armadillo-repeat containing domain through which it binds the cytoplasmic tail of classical cadherins; meanwhile, it also binds alpha-catenin, which further links the cadherin complex to the actin cytoskeleton either directly or indirectly. Beta-catenin is therefore necessary for the adhesive function of classical cadherins. Another key function of this protein is to mediate the canonical Wnt signaling pathway and regulate gene transcription. Without Wnt signal, cytoplasmic beta-catenin that is not associated with the cadherin complex is quickly phosphorylated at the N-terminal Ser/Thr residues by the so called degradation complex containing axin, adenomatous polyposis coli (APC), casein kinase I, and GSK3B, then ubiquitylated by beta-TrCP, and degraded by the proteasome. However, in the presence of Wnt signal, the degradation complex is disrupted and the stabilized cytoplasmic beta-catenin translocates into the nucleus, where it binds various transcription factors and, together with these factors, regulates the transcription of many downstream genes. Mutations of this gene have been linked with various types of tumors. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null embryos show anterior-posterior axis formation anomalies, but develop to E7. Multiple conditional mutations have shown defects in distinct stem cell types that result in proliferation defects, such as intestinal polyps, brain and spinal cord size anomalies, etc. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	G	A	5: 3,627,248 (GRCm39)	V75I	possibly damaging	Het
AA986860	A	G	1: 130,670,344 (GRCm39)	K189E	probably benign	Het
Abcf1	C	T	17: 36,270,402 (GRCm39)	R596H	possibly damaging	Het
Abtb3	C	A	10: 85,468,134 (GRCm39)	H810N	probably damaging	Het
Axl	T	C	7: 25,460,169 (GRCm39)		probably benign	Het
Birc6	A	G	17: 74,886,603 (GRCm39)	K644E	probably benign	Het
Btnl7-ps	T	A	17: 34,760,489 (GRCm39)		noncoding transcript	Het
Car8	A	T	4: 8,184,576 (GRCm39)		probably benign	Het
Ccdc62	C	T	5: 124,092,778 (GRCm39)	R588C	probably damaging	Het
Clasp2	T	G	9: 113,737,805 (GRCm39)	S374A	probably damaging	Het
Cwf19l2	A	G	9: 3,456,776 (GRCm39)	H703R	probably damaging	Het
Efcab7	A	T	4: 99,735,375 (GRCm39)	Q133L	probably damaging	Het
Ehmt2	T	C	17: 35,122,443 (GRCm39)	S280P	probably damaging	Het
Eif4a3l1	A	T	6: 136,306,420 (GRCm39)	T294S	probably benign	Het
Eomes	A	G	9: 118,310,341 (GRCm39)	M351V	probably benign	Het
Ets2	G	A	16: 95,520,037 (GRCm39)	R421H	probably damaging	Het
Fam222b	C	G	11: 78,045,756 (GRCm39)	P439R	probably benign	Het
Gbp11	T	A	5: 105,478,978 (GRCm39)	K153N	probably damaging	Het
Golim4	T	C	3: 75,810,634 (GRCm39)	T174A	probably damaging	Het
Grid1	A	G	14: 35,242,684 (GRCm39)	Y679C	probably damaging	Het
Gvin-ps5	A	G	7: 105,929,445 (GRCm39)	S151P	probably benign	Het
Ikzf3	T	C	11: 98,381,412 (GRCm39)	D56G	probably damaging	Het
Kcnj16	A	G	11: 110,916,382 (GRCm39)	D348G	probably benign	Het
Kidins220	T	C	12: 25,103,957 (GRCm39)	L1319P	possibly damaging	Het
Lrp1b	T	A	2: 41,339,248 (GRCm39)	D751V	probably damaging	Het
Macc1	T	C	12: 119,410,551 (GRCm39)	C440R	probably benign	Het
Mbd2	T	C	18: 70,755,680 (GRCm39)	V382A	probably benign	Het
Or13a17	T	A	7: 140,270,888 (GRCm39)	D23E	probably benign	Het
Or51a25	C	T	7: 102,373,409 (GRCm39)	R96H	possibly damaging	Het
Or6c68	G	A	10: 129,158,178 (GRCm39)	A229T	probably benign	Het
Pgs1	T	G	11: 117,910,472 (GRCm39)	S528A	probably benign	Het
Pitpnm3	T	C	11: 72,003,110 (GRCm39)	T67A	probably damaging	Het
Pnliprp2	T	G	19: 58,748,794 (GRCm39)	V33G	probably damaging	Het
Ptn	T	C	6: 36,720,282 (GRCm39)	N90S	probably damaging	Het
Ptprt	A	T	2: 161,397,475 (GRCm39)		probably benign	Het
Ranbp17	G	A	11: 33,429,189 (GRCm39)	A352V	probably benign	Het
Rasgrp1	G	A	2: 117,119,122 (GRCm39)	S505F	probably damaging	Het
Sesn1	G	A	10: 41,770,886 (GRCm39)	R139H	probably benign	Het
Slc17a7	T	A	7: 44,818,144 (GRCm39)	L23Q	probably damaging	Het
Slc30a10	G	T	1: 185,187,333 (GRCm39)	E25*	probably null	Het
Smco1	A	G	16: 32,092,583 (GRCm39)	I85V	probably benign	Het
Vmn1r76	A	T	7: 11,664,496 (GRCm39)	S239R	probably benign	Het
Zc3h7a	A	T	16: 10,974,074 (GRCm39)	V237D	possibly damaging	Het

Other mutations in Ctnnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0092:Ctnnb1	UTSW	9	120,781,929 (GRCm39)	missense	possibly damaging	0.78
R0326:Ctnnb1	UTSW	9	120,780,778 (GRCm39)	missense	probably benign	0.01
R0561:Ctnnb1	UTSW	9	120,780,788 (GRCm39)	missense	probably damaging	0.97
R1017:Ctnnb1	UTSW	9	120,779,794 (GRCm39)	missense	probably damaging	0.99
R1918:Ctnnb1	UTSW	9	120,780,100 (GRCm39)	missense	possibly damaging	0.80
R3892:Ctnnb1	UTSW	9	120,779,580 (GRCm39)	splice site	probably benign
R4869:Ctnnb1	UTSW	9	120,782,060 (GRCm39)	missense	possibly damaging	0.93
R5707:Ctnnb1	UTSW	9	120,784,234 (GRCm39)	missense	probably benign	0.01
R6744:Ctnnb1	UTSW	9	120,782,025 (GRCm39)	missense	probably damaging	0.99
R7466:Ctnnb1	UTSW	9	120,784,482 (GRCm39)	missense	probably damaging	1.00
R7707:Ctnnb1	UTSW	9	120,781,931 (GRCm39)	missense	possibly damaging	0.77
R8434:Ctnnb1	UTSW	9	120,786,628 (GRCm39)	missense	possibly damaging	0.82
R8796:Ctnnb1	UTSW	9	120,784,498 (GRCm39)	missense	probably damaging	1.00
R8978:Ctnnb1	UTSW	9	120,786,650 (GRCm39)	missense	probably damaging	0.99
R9058:Ctnnb1	UTSW	9	120,780,476 (GRCm39)	nonsense	probably null
R9309:Ctnnb1	UTSW	9	120,784,504 (GRCm39)	missense	probably benign	0.03
R9712:Ctnnb1	UTSW	9	120,784,895 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATAGAGGCTCTTGTACGCACC -3'
(R):5'- TCGTGGAATAGCACCCTGTTC -3'

Sequencing Primer
(F):5'- CGTCCTTCGTGCTGGTGAC -3'
(R):5'- GGCAAGGTTTCGAATCAATCC -3'

Posted On

2015-04-17