Incidental Mutation 'R3915:Fam222b'
ID309608
Institutional Source Beutler Lab
Gene Symbol Fam222b
Ensembl Gene ENSMUSG00000037750
Gene Namefamily with sequence similarity 222, member B
Synonyms
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78094660-78156700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 78154930 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 439 (P439R)
Ref Sequence ENSEMBL: ENSMUSP00000121832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000073705] [ENSMUST00000100782] [ENSMUST00000155571]
Predicted Effect probably benign
Transcript: ENSMUST00000017530
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073705
AA Change: P439R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073384
Gene: ENSMUSG00000037750
AA Change: P439R

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 5.6e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100782
AA Change: P311R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126620
Gene: ENSMUSG00000037750
AA Change: P311R

DomainStartEndE-ValueType
Pfam:FAM222A 1 434 1.9e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149437
Predicted Effect probably benign
Transcript: ENSMUST00000155571
AA Change: P439R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121832
Gene: ENSMUSG00000037750
AA Change: P439R

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 3.2e-259 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Fam222b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Fam222b APN 11 78154488 missense probably damaging 0.96
IGL01948:Fam222b APN 11 78154339 missense probably damaging 1.00
IGL02967:Fam222b APN 11 78154108 missense probably benign 0.44
H8562:Fam222b UTSW 11 78154578 missense probably damaging 0.99
R0087:Fam222b UTSW 11 78153892 missense probably benign 0.23
R0385:Fam222b UTSW 11 78154930 missense probably benign 0.01
R0478:Fam222b UTSW 11 78153856 missense probably damaging 1.00
R1565:Fam222b UTSW 11 78154662 missense possibly damaging 0.82
R1586:Fam222b UTSW 11 78154521 missense probably damaging 1.00
R1661:Fam222b UTSW 11 78155161 missense probably damaging 1.00
R1829:Fam222b UTSW 11 78155035 missense probably damaging 0.96
R1878:Fam222b UTSW 11 78143216 critical splice donor site probably null
R2301:Fam222b UTSW 11 78154543 missense probably damaging 1.00
R3120:Fam222b UTSW 11 78153916 missense probably damaging 1.00
R4003:Fam222b UTSW 11 78154929 missense probably benign 0.13
R4748:Fam222b UTSW 11 78154603 missense possibly damaging 0.59
R4982:Fam222b UTSW 11 78154743 missense probably damaging 0.98
R5307:Fam222b UTSW 11 78153768 missense probably damaging 1.00
R5590:Fam222b UTSW 11 78155032 missense probably benign 0.16
R5618:Fam222b UTSW 11 78154240 missense probably benign 0.05
R7181:Fam222b UTSW 11 78154978 missense probably damaging 1.00
R7199:Fam222b UTSW 11 78154857 missense possibly damaging 0.55
R7285:Fam222b UTSW 11 78143181 missense probably benign 0.04
R7467:Fam222b UTSW 11 78154347 missense probably damaging 1.00
R7726:Fam222b UTSW 11 78153751 missense probably damaging 1.00
R7804:Fam222b UTSW 11 78154153 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCACCTACAACAGATGTGC -3'
(R):5'- AAGCTGTTCTGGCTTGCCAC -3'

Sequencing Primer
(F):5'- CCTACAACAGATGTGCAGCGAG -3'
(R):5'- GTTCTGGCTTGCCACTGGAC -3'
Posted On2015-04-17