Incidental Mutation 'R3915:Macc1'
ID309613
Institutional Source Beutler Lab
Gene Symbol Macc1
Ensembl Gene ENSMUSG00000041886
Gene Namemetastasis associated in colon cancer 1
Synonyms
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location119314270-119469987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119446816 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 440 (C440R)
Ref Sequence ENSEMBL: ENSMUSP00000152677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048880] [ENSMUST00000221866] [ENSMUST00000221917] [ENSMUST00000222058] [ENSMUST00000222784]
Predicted Effect probably benign
Transcript: ENSMUST00000048880
AA Change: C440R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042955
Gene: ENSMUSG00000041886
AA Change: C440R

DomainStartEndE-ValueType
low complexity region 127 141 N/A INTRINSIC
Pfam:ZU5 213 307 3.5e-10 PFAM
SH3 551 617 3.74e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221866
AA Change: C440R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000221917
AA Change: C440R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000222058
AA Change: C440R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000222784
AA Change: C440R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MACC1 is a key regulator of the hepatocyte growth factor (HGF; MIM 142409)-HGF receptor (HGFR, or MET; MIM 164860) pathway, which is involved in cellular growth, epithelial-mesenchymal transition, angiogenesis, cell motility, invasiveness, and metastasis. Expression of MACC1 in colon cancer (MIM 114500) specimens is an independent prognostic indicator for metastasis formation and metastasis-free survival (Stein et al., 2009 [PubMed 19098908]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Macc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Macc1 APN 12 119447014 missense probably benign 0.16
IGL01515:Macc1 APN 12 119450371 missense probably damaging 1.00
IGL01638:Macc1 APN 12 119446511 missense probably benign 0.00
IGL01653:Macc1 APN 12 119450353 missense probably damaging 1.00
IGL01982:Macc1 APN 12 119445634 missense probably benign 0.12
IGL02177:Macc1 APN 12 119465557 missense probably damaging 1.00
IGL02263:Macc1 APN 12 119446017 missense possibly damaging 0.87
IGL03199:Macc1 APN 12 119446421 missense probably benign 0.24
IGL03246:Macc1 APN 12 119446685 missense probably benign 0.00
IGL03265:Macc1 APN 12 119446976 missense probably benign 0.00
IGL03306:Macc1 APN 12 119446868 missense probably benign 0.00
IGL03307:Macc1 APN 12 119446420 missense probably benign
IGL03386:Macc1 APN 12 119445863 missense probably benign
PIT4366001:Macc1 UTSW 12 119446949 missense probably benign 0.01
PIT4431001:Macc1 UTSW 12 119446511 missense probably benign 0.00
R0033:Macc1 UTSW 12 119446341 missense probably benign 0.03
R0166:Macc1 UTSW 12 119447080 nonsense probably null
R0528:Macc1 UTSW 12 119447045 missense probably benign 0.09
R0688:Macc1 UTSW 12 119447003 missense probably damaging 0.96
R0725:Macc1 UTSW 12 119447516 nonsense probably null
R1356:Macc1 UTSW 12 119446555 missense probably benign 0.00
R1647:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1648:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1938:Macc1 UTSW 12 119445731 missense probably damaging 1.00
R2362:Macc1 UTSW 12 119447658 splice site probably benign
R2406:Macc1 UTSW 12 119465611 missense probably damaging 0.99
R3123:Macc1 UTSW 12 119447633 missense probably damaging 1.00
R3713:Macc1 UTSW 12 119446841 missense probably benign
R5256:Macc1 UTSW 12 119446529 missense possibly damaging 0.87
R5329:Macc1 UTSW 12 119446477 missense probably damaging 1.00
R5555:Macc1 UTSW 12 119450375 missense probably benign 0.24
R5992:Macc1 UTSW 12 119447585 missense probably damaging 0.96
R6024:Macc1 UTSW 12 119450425 missense probably benign 0.01
R6064:Macc1 UTSW 12 119445665 missense probably benign 0.14
R6196:Macc1 UTSW 12 119446050 missense probably damaging 1.00
R6697:Macc1 UTSW 12 119447256 missense possibly damaging 0.73
R7046:Macc1 UTSW 12 119447038 missense probably benign 0.02
R7060:Macc1 UTSW 12 119447455 missense probably damaging 1.00
R7094:Macc1 UTSW 12 119450391 nonsense probably null
R7120:Macc1 UTSW 12 119445745 missense possibly damaging 0.87
R7496:Macc1 UTSW 12 119446999 missense possibly damaging 0.56
R7534:Macc1 UTSW 12 119447519 missense probably benign 0.45
R7591:Macc1 UTSW 12 119446658 missense probably damaging 0.99
R7715:Macc1 UTSW 12 119446256 missense possibly damaging 0.72
R7823:Macc1 UTSW 12 119447065 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACCAGCTGCTACTATTTGG -3'
(R):5'- GACAAAGAACTGTGTCACTGG -3'

Sequencing Primer
(F):5'- ACCACCTCTATTGGAATTTATGGACC -3'
(R):5'- CAAAGAACTGTGTCACTGGTTTTTC -3'
Posted On2015-04-17