Incidental Mutation 'R3915:Grid1'
ID309614
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35520727 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 679 (Y679C)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably damaging
Transcript: ENSMUST00000043349
AA Change: Y679C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: Y679C

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Meta Mutation Damage Score 0.8392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACATATGGAGGTCTGGCTC -3'
(R):5'- GTACCCAGATTCCAATTCTTGC -3'

Sequencing Primer
(F):5'- CCAGGCTGAGGGATTGATGC -3'
(R):5'- GCCTACCTTCCTGATACCTTCTGAAG -3'
Posted On2015-04-17