Incidental Mutation 'R3915:Ets2'
ID309617
Institutional Source Beutler Lab
Gene Symbol Ets2
Ensembl Gene ENSMUSG00000022895
Gene NameE26 avian leukemia oncogene 2, 3' domain
SynonymsEts-2
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95702407-95721045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95718993 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 421 (R421H)
Ref Sequence ENSEMBL: ENSMUSP00000023612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023612]
Predicted Effect probably damaging
Transcript: ENSMUST00000023612
AA Change: R421H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023612
Gene: ENSMUSG00000022895
AA Change: R421H

DomainStartEndE-ValueType
SAM_PNT 87 170 3.35e-43 SMART
low complexity region 259 269 N/A INTRINSIC
ETS 361 446 8.49e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140544
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defective trophoblast formation and die by embryonic day 8.5, but tetraploid chimeric rescue results in viable and fertile mutants with wavy hair. Mammary tumors induced in carriers are reduced in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Smco1 A G 16: 32,273,765 I85V probably benign Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Ets2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Ets2 APN 16 95712141 missense probably benign 0.01
IGL00843:Ets2 APN 16 95709793 missense probably benign 0.03
IGL01911:Ets2 APN 16 95711758 missense probably damaging 1.00
R0257:Ets2 UTSW 16 95712201 nonsense probably null
R0317:Ets2 UTSW 16 95712149 missense probably damaging 1.00
R0398:Ets2 UTSW 16 95716223 missense probably damaging 1.00
R0478:Ets2 UTSW 16 95716262 missense probably damaging 1.00
R0634:Ets2 UTSW 16 95716156 missense possibly damaging 0.87
R1621:Ets2 UTSW 16 95709869 missense probably damaging 1.00
R1868:Ets2 UTSW 16 95715074 missense probably benign 0.00
R2120:Ets2 UTSW 16 95718933 missense probably benign 0.17
R3037:Ets2 UTSW 16 95716065 missense probably benign 0.19
R4086:Ets2 UTSW 16 95709789 missense probably damaging 1.00
R4609:Ets2 UTSW 16 95711774 missense probably benign 0.03
R4760:Ets2 UTSW 16 95719043 missense probably damaging 1.00
R5245:Ets2 UTSW 16 95712260 nonsense probably null
R5551:Ets2 UTSW 16 95712121 missense probably damaging 1.00
R6057:Ets2 UTSW 16 95714372 missense probably benign 0.00
R6376:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R7545:Ets2 UTSW 16 95715083 missense probably benign 0.45
R7905:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R7988:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R8013:Ets2 UTSW 16 95716100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAACATCTGTCGGTCCCAG -3'
(R):5'- CTTTGGAGCAAGTGGGTCAG -3'

Sequencing Primer
(F):5'- CCCAGTGACAGTCAGGTTTTTCAG -3'
(R):5'- ACGGGCTTCCCACTCAGTC -3'
Posted On2015-04-17