Incidental Mutation 'R3886:Kcnb2'
ID309624
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 2
Synonyms9630047L19Rik, Kv2.2
MMRRC Submission 040798-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3886 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location15287254-15723750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15710415 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 504 (S504P)
Ref Sequence ENSEMBL: ENSMUSP00000135382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
Predicted Effect probably damaging
Transcript: ENSMUST00000170146
AA Change: S504P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000175681
AA Change: S504P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: S504P

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,213 N331S probably benign Het
2410089E03Rik T A 15: 8,171,805 V22E probably damaging Het
4933407L21Rik T A 1: 85,940,551 probably null Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B020004J07Rik T C 4: 101,835,723 K360R probably benign Het
Ccdc73 A T 2: 104,991,343 T546S possibly damaging Het
Cd22 T C 7: 30,870,107 D354G possibly damaging Het
Chchd6 T C 6: 89,467,451 E183G probably damaging Het
Col6a5 A G 9: 105,930,930 L973P unknown Het
Cp T C 3: 19,989,111 L1021P probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
D630045J12Rik A G 6: 38,142,698 V1703A possibly damaging Het
Dennd1a T C 2: 37,858,077 N376S possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Ect2l C T 10: 18,168,458 V310M probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gm8674 T C 13: 49,902,163 noncoding transcript Het
Ice1 T C 13: 70,605,370 T866A probably benign Het
Jade2 C T 11: 51,830,499 V201I possibly damaging Het
Kcng4 T C 8: 119,633,247 K130R probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrrk1 C T 7: 66,292,364 V709I probably damaging Het
Mdh1 A G 11: 21,559,832 V181A probably damaging Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr978 A G 9: 39,994,539 H243R probably damaging Het
Papd5 C A 8: 88,200,415 A151E probably benign Het
Ppp1r3a A C 6: 14,719,912 D334E possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G A 13: 37,898,506 probably null Het
Slc35f2 T A 9: 53,816,957 S372T probably benign Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Tnxb A G 17: 34,718,911 D3896G probably damaging Het
Tti1 A G 2: 158,008,950 V123A possibly damaging Het
Usp1 T C 4: 98,929,736 C147R probably damaging Het
Vill A G 9: 119,066,714 N106S probably benign Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15709567 missense probably benign
R3025:Kcnb2 UTSW 1 15710835 missense possibly damaging 0.87
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15710256 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15709807 missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15710613 missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15312780 missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15711627 makesense probably null
R8156:Kcnb2 UTSW 1 15710056 missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15711553 missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15312710 missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15710652 missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15710424 missense probably benign 0.07
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Z1177:Kcnb2 UTSW 1 15710958 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAATGGCAGCATCGTTTCTATG -3'
(R):5'- TGTGGGCAGATCACCTCTTC -3'

Sequencing Primer
(F):5'- CGTTTCTATGAACTTAAAGGATGCC -3'
(R):5'- TACACACATGGCCTCTCAGG -3'
Posted On2015-04-17