Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Kcnb2'

309624

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

040798-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15710415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 504 (S504P)

Ref Sequence

ENSEMBL: ENSMUSP00000135382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

probably damaging
Transcript: ENSMUST00000170146
AA Change: S504P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000175681
AA Change: S504P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: S504P

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Cd22	T	C	7: 30,870,107	D354G	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dennd1a	T	C	2: 37,858,077	N376S	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrrk1	C	T	7: 66,292,364	V709I	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ppp1r3a	A	C	6: 14,719,912	D334E	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Tti1	A	G	2: 158,008,950	V123A	possibly damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het
Vill	A	G	9: 119,066,714	N106S	probably benign	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2166:Kcnb2	UTSW	1	15711316	missense	possibly damaging	0.82
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5096:Kcnb2	UTSW	1	15710844	missense	probably benign	0.45
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6371:Kcnb2	UTSW	1	15711212	missense	probably benign
R6724:Kcnb2	UTSW	1	15710440	missense	probably damaging	1.00
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7043:Kcnb2	UTSW	1	15312926	missense	probably benign
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8156:Kcnb2	UTSW	1	15710056	missense	probably damaging	1.00
R8408:Kcnb2	UTSW	1	15711553	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AAATGGCAGCATCGTTTCTATG -3'
(R):5'- TGTGGGCAGATCACCTCTTC -3'

Sequencing Primer
(F):5'- CGTTTCTATGAACTTAAAGGATGCC -3'
(R):5'- TACACACATGGCCTCTCAGG -3'

Posted On

2015-04-17