Incidental Mutation 'R3886:Kcnb2'
ID 309624
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms Kv2.2, 9630047L19Rik
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 15357478-15793974 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15780639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 504 (S504P)
Ref Sequence ENSEMBL: ENSMUSP00000135382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect probably damaging
Transcript: ENSMUST00000170146
AA Change: S504P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000175681
AA Change: S504P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: S504P

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ccdc73 A T 2: 104,821,688 (GRCm39) T546S possibly damaging Het
Cd22 T C 7: 30,569,532 (GRCm39) D354G possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gm8674 T C 13: 50,056,199 (GRCm39) noncoding transcript Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrrk1 C T 7: 65,942,112 (GRCm39) V709I probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Vill A G 9: 118,895,782 (GRCm39) N106S probably benign Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15,781,236 (GRCm39) missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15,383,147 (GRCm39) missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15,781,048 (GRCm39) missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15,383,178 (GRCm39) missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15,781,033 (GRCm39) missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15,780,085 (GRCm39) missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15,781,159 (GRCm39) missense probably benign
IGL02526:Kcnb2 APN 1 15,780,979 (GRCm39) missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15,780,730 (GRCm39) missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15,781,435 (GRCm39) missense probably benign
IGL03144:Kcnb2 APN 1 15,780,112 (GRCm39) missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15,383,200 (GRCm39) missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15,783,137 (GRCm39) unclassified probably benign
R0538:Kcnb2 UTSW 1 15,783,108 (GRCm39) unclassified probably benign
R0611:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15,781,012 (GRCm39) missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15,779,979 (GRCm39) missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15,779,990 (GRCm39) missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15,781,540 (GRCm39) missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15,779,791 (GRCm39) missense probably benign
R3025:Kcnb2 UTSW 1 15,781,059 (GRCm39) missense possibly damaging 0.87
R5010:Kcnb2 UTSW 1 15,383,186 (GRCm39) missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15,779,724 (GRCm39) missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15,781,068 (GRCm39) missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15,781,716 (GRCm39) missense probably benign
R5926:Kcnb2 UTSW 1 15,383,235 (GRCm39) missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15,780,790 (GRCm39) missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15,781,436 (GRCm39) missense probably benign
R6724:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15,780,480 (GRCm39) missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15,383,150 (GRCm39) missense probably benign
R7352:Kcnb2 UTSW 1 15,780,835 (GRCm39) missense probably benign
R7419:Kcnb2 UTSW 1 15,781,251 (GRCm39) missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15,780,031 (GRCm39) missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15,383,064 (GRCm39) missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15,780,837 (GRCm39) missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15,383,004 (GRCm39) missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15,781,851 (GRCm39) makesense probably null
R8156:Kcnb2 UTSW 1 15,780,280 (GRCm39) missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15,781,777 (GRCm39) missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15,382,934 (GRCm39) missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15,780,876 (GRCm39) missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15,780,648 (GRCm39) missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15,781,723 (GRCm39) missense probably benign
R9321:Kcnb2 UTSW 1 15,779,793 (GRCm39) missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15,779,737 (GRCm39) missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15,781,444 (GRCm39) missense probably benign
R9709:Kcnb2 UTSW 1 15,780,523 (GRCm39) missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15,781,252 (GRCm39) missense probably benign 0.01
Z1088:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.03
Z1177:Kcnb2 UTSW 1 15,781,182 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAATGGCAGCATCGTTTCTATG -3'
(R):5'- TGTGGGCAGATCACCTCTTC -3'

Sequencing Primer
(F):5'- CGTTTCTATGAACTTAAAGGATGCC -3'
(R):5'- TACACACATGGCCTCTCAGG -3'
Posted On 2015-04-17