Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Dennd1a'

309633

Institutional Source

Beutler Lab

Gene Symbol

Dennd1a

Ensembl Gene

ENSMUSG00000035392

Gene Name

DENN/MADD domain containing 1A

Synonyms

6030446I19Rik

MMRRC Submission

040798-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.232) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37798991-38287390 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37858077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 376 (N376S)

Ref Sequence

ENSEMBL: ENSMUSP00000099848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000140552]

AlphaFold

Q8K382

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102787
AA Change: N376S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: N376S

Domain	Start	End	E-Value	Type
uDENN	9	91	1.44e-26	SMART
DENN	92	273	2.09e-73	SMART
dDENN	304	371	1.37e-18	SMART
low complexity region	497	508	N/A	INTRINSIC
low complexity region	689	702	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	772	786	N/A	INTRINSIC
low complexity region	801	815	N/A	INTRINSIC
low complexity region	822	856	N/A	INTRINSIC
low complexity region	952	972	N/A	INTRINSIC
low complexity region	991	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140552

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Cd22	T	C	7: 30,870,107	D354G	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcnb2	T	C	1: 15,710,415	S504P	probably damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrrk1	C	T	7: 66,292,364	V709I	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ppp1r3a	A	C	6: 14,719,912	D334E	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Tti1	A	G	2: 158,008,950	V123A	possibly damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het
Vill	A	G	9: 119,066,714	N106S	probably benign	Het

Other mutations in Dennd1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Dennd1a	APN	2	38243442	nonsense	probably null
IGL00490:Dennd1a	APN	2	37801152	missense	probably damaging	1.00
IGL00839:Dennd1a	APN	2	37816982	missense	probably benign	0.30
IGL01065:Dennd1a	APN	2	37844905	missense	probably benign	0.02
IGL01621:Dennd1a	APN	2	37844809	missense	probably damaging	1.00
IGL01792:Dennd1a	APN	2	38126580	missense	probably damaging	1.00
IGL01799:Dennd1a	APN	2	38048742	missense	probably damaging	1.00
IGL02516:Dennd1a	APN	2	37852394	critical splice donor site	probably null
contract	UTSW	2	37852441	missense	possibly damaging	0.89
R0018:Dennd1a	UTSW	2	37858460	missense	possibly damaging	0.72
R0018:Dennd1a	UTSW	2	37858460	missense	possibly damaging	0.72
R0144:Dennd1a	UTSW	2	38126640	missense	probably damaging	0.96
R0784:Dennd1a	UTSW	2	38021414	missense	probably damaging	1.00
R1199:Dennd1a	UTSW	2	37961716	missense	probably damaging	0.99
R1439:Dennd1a	UTSW	2	38043400	missense	probably damaging	1.00
R1563:Dennd1a	UTSW	2	37858429	missense	probably damaging	1.00
R1608:Dennd1a	UTSW	2	37852434	missense	probably benign	0.18
R1720:Dennd1a	UTSW	2	37800197	nonsense	probably null
R1967:Dennd1a	UTSW	2	37844833	missense	probably benign
R2570:Dennd1a	UTSW	2	37844783	missense	probably damaging	1.00
R4464:Dennd1a	UTSW	2	38243390	splice site	probably benign
R4890:Dennd1a	UTSW	2	38176226	intron	probably benign
R5395:Dennd1a	UTSW	2	37802128	missense	probably damaging	1.00
R5652:Dennd1a	UTSW	2	37801126	missense	probably benign	0.00
R5882:Dennd1a	UTSW	2	37961663	missense	probably damaging	1.00
R6285:Dennd1a	UTSW	2	37852441	missense	possibly damaging	0.89
R6520:Dennd1a	UTSW	2	37961747	splice site	probably null
R6934:Dennd1a	UTSW	2	37801213	missense	possibly damaging	0.62
R7053:Dennd1a	UTSW	2	37961654	missense	probably damaging	1.00
R7109:Dennd1a	UTSW	2	38048792	missense	probably damaging	1.00
R7204:Dennd1a	UTSW	2	38039203	missense	probably damaging	1.00
R7235:Dennd1a	UTSW	2	37801061	missense	probably benign
R7408:Dennd1a	UTSW	2	37852172	splice site	probably null
R7446:Dennd1a	UTSW	2	37816979	missense	possibly damaging	0.89
R7579:Dennd1a	UTSW	2	37858432	missense	probably damaging	0.99
R7645:Dennd1a	UTSW	2	38021363	missense	probably damaging	1.00
R7661:Dennd1a	UTSW	2	37844829	missense	probably benign
R8132:Dennd1a	UTSW	2	37858060	missense	probably damaging	1.00
R8305:Dennd1a	UTSW	2	37858081	missense	probably damaging	1.00
R8369:Dennd1a	UTSW	2	38048754	missense	probably damaging	1.00
R8418:Dennd1a	UTSW	2	37858391	missense	probably benign	0.36
R8438:Dennd1a	UTSW	2	37856138	missense	probably benign	0.08
R8544:Dennd1a	UTSW	2	37982908	splice site	probably null
R8997:Dennd1a	UTSW	2	37800485	missense	probably benign	0.14
R9052:Dennd1a	UTSW	2	38021451	missense	probably damaging	1.00
R9087:Dennd1a	UTSW	2	38021354	critical splice donor site	probably null
R9096:Dennd1a	UTSW	2	37800065	missense	probably damaging	1.00
R9346:Dennd1a	UTSW	2	38021435	missense	probably benign	0.12
Z1088:Dennd1a	UTSW	2	37800692	missense	probably benign
Z1177:Dennd1a	UTSW	2	37800257	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGCATCCTGTCACAAAACAG -3'
(R):5'- TACCTTTGGCACTAAGAATGGGG -3'

Sequencing Primer
(F):5'- TGTCACAAAACAGGGAATTTCC -3'
(R):5'- GGCCTAGAGAGGACCAGTG -3'

Posted On

2015-04-17