Incidental Mutation 'R3886:Or4a71'
ID 309636
Institutional Source Beutler Lab
Gene Symbol Or4a71
Ensembl Gene ENSMUSG00000075084
Gene Name olfactory receptor family 4 subfamily A member 71
Synonyms Olfr1243, MOR231-4, GA_x6K02T2Q125-50972538-50971621
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89357835-89358752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89358076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 226 (H226L)
Ref Sequence ENSEMBL: ENSMUSP00000149464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099775] [ENSMUST00000144885]
AlphaFold Q8VGM7
Predicted Effect possibly damaging
Transcript: ENSMUST00000099775
AA Change: H226L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097363
Gene: ENSMUSG00000075084
AA Change: H226L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 2.1e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144885
AA Change: H226L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216635
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ccdc73 A T 2: 104,821,688 (GRCm39) T546S possibly damaging Het
Cd22 T C 7: 30,569,532 (GRCm39) D354G possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gm8674 T C 13: 50,056,199 (GRCm39) noncoding transcript Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcnb2 T C 1: 15,780,639 (GRCm39) S504P probably damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrrk1 C T 7: 65,942,112 (GRCm39) V709I probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Vill A G 9: 118,895,782 (GRCm39) N106S probably benign Het
Other mutations in Or4a71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Or4a71 APN 2 89,358,551 (GRCm39) missense probably damaging 1.00
IGL01940:Or4a71 APN 2 89,358,154 (GRCm39) missense probably damaging 0.99
IGL02553:Or4a71 APN 2 89,358,275 (GRCm39) missense probably benign
R0105:Or4a71 UTSW 2 89,358,707 (GRCm39) missense probably benign 0.00
R0105:Or4a71 UTSW 2 89,358,707 (GRCm39) missense probably benign 0.00
R0607:Or4a71 UTSW 2 89,358,451 (GRCm39) missense possibly damaging 0.88
R0764:Or4a71 UTSW 2 89,358,340 (GRCm39) missense probably benign 0.05
R1779:Or4a71 UTSW 2 89,357,989 (GRCm39) missense probably benign 0.15
R2221:Or4a71 UTSW 2 89,358,281 (GRCm39) missense probably benign 0.05
R3853:Or4a71 UTSW 2 89,357,917 (GRCm39) missense possibly damaging 0.94
R3887:Or4a71 UTSW 2 89,358,076 (GRCm39) missense possibly damaging 0.81
R3888:Or4a71 UTSW 2 89,358,076 (GRCm39) missense possibly damaging 0.81
R4431:Or4a71 UTSW 2 89,357,987 (GRCm39) missense probably damaging 1.00
R4479:Or4a71 UTSW 2 89,358,514 (GRCm39) missense possibly damaging 0.89
R6807:Or4a71 UTSW 2 89,357,932 (GRCm39) missense probably damaging 1.00
R7025:Or4a71 UTSW 2 89,357,948 (GRCm39) missense probably damaging 0.98
R7094:Or4a71 UTSW 2 89,357,902 (GRCm39) missense probably damaging 1.00
R7144:Or4a71 UTSW 2 89,357,901 (GRCm39) missense probably damaging 1.00
R7972:Or4a71 UTSW 2 89,357,948 (GRCm39) missense probably benign 0.02
R8013:Or4a71 UTSW 2 89,358,280 (GRCm39) missense probably benign 0.05
R9101:Or4a71 UTSW 2 89,358,721 (GRCm39) missense possibly damaging 0.93
R9112:Or4a71 UTSW 2 89,358,337 (GRCm39) missense probably damaging 1.00
R9179:Or4a71 UTSW 2 89,358,494 (GRCm39) nonsense probably null
R9193:Or4a71 UTSW 2 89,357,987 (GRCm39) missense probably damaging 1.00
R9708:Or4a71 UTSW 2 89,358,214 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCACAGCATCCCTTGTTAG -3'
(R):5'- GGTCCCAATGTCATTGATCACTTC -3'

Sequencing Primer
(F):5'- GCACAGCATCCCTTGTTAGAATTTAC -3'
(R):5'- CCAATGTCATTGATCACTTCATGTG -3'
Posted On 2015-04-17