Incidental Mutation 'R3886:Olfr1243'
ID309636
Institutional Source Beutler Lab
Gene Symbol Olfr1243
Ensembl Gene ENSMUSG00000075084
Gene Nameolfactory receptor 1243
SynonymsGA_x6K02T2Q125-50972538-50971621, MOR231-4
MMRRC Submission 040798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3886 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89525889-89531487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89527732 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 226 (H226L)
Ref Sequence ENSEMBL: ENSMUSP00000149464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099775] [ENSMUST00000144885]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099775
AA Change: H226L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097363
Gene: ENSMUSG00000075084
AA Change: H226L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 2.1e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144885
AA Change: H226L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216635
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,213 N331S probably benign Het
2410089E03Rik T A 15: 8,171,805 V22E probably damaging Het
4933407L21Rik T A 1: 85,940,551 probably null Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B020004J07Rik T C 4: 101,835,723 K360R probably benign Het
Ccdc73 A T 2: 104,991,343 T546S possibly damaging Het
Cd22 T C 7: 30,870,107 D354G possibly damaging Het
Chchd6 T C 6: 89,467,451 E183G probably damaging Het
Col6a5 A G 9: 105,930,930 L973P unknown Het
Cp T C 3: 19,989,111 L1021P probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
D630045J12Rik A G 6: 38,142,698 V1703A possibly damaging Het
Dennd1a T C 2: 37,858,077 N376S possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Ect2l C T 10: 18,168,458 V310M probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gm8674 T C 13: 49,902,163 noncoding transcript Het
Ice1 T C 13: 70,605,370 T866A probably benign Het
Jade2 C T 11: 51,830,499 V201I possibly damaging Het
Kcnb2 T C 1: 15,710,415 S504P probably damaging Het
Kcng4 T C 8: 119,633,247 K130R probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrrk1 C T 7: 66,292,364 V709I probably damaging Het
Mdh1 A G 11: 21,559,832 V181A probably damaging Het
Olfr978 A G 9: 39,994,539 H243R probably damaging Het
Papd5 C A 8: 88,200,415 A151E probably benign Het
Ppp1r3a A C 6: 14,719,912 D334E possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G A 13: 37,898,506 probably null Het
Slc35f2 T A 9: 53,816,957 S372T probably benign Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Tnxb A G 17: 34,718,911 D3896G probably damaging Het
Tti1 A G 2: 158,008,950 V123A possibly damaging Het
Usp1 T C 4: 98,929,736 C147R probably damaging Het
Vill A G 9: 119,066,714 N106S probably benign Het
Other mutations in Olfr1243
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr1243 APN 2 89528207 missense probably damaging 1.00
IGL01940:Olfr1243 APN 2 89527810 missense probably damaging 0.99
IGL02553:Olfr1243 APN 2 89527931 missense probably benign
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0607:Olfr1243 UTSW 2 89528107 missense possibly damaging 0.88
R0764:Olfr1243 UTSW 2 89527996 missense probably benign 0.05
R1779:Olfr1243 UTSW 2 89527645 missense probably benign 0.15
R2221:Olfr1243 UTSW 2 89527937 missense probably benign 0.05
R3853:Olfr1243 UTSW 2 89527573 missense possibly damaging 0.94
R3887:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R3888:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R4431:Olfr1243 UTSW 2 89527643 missense probably damaging 1.00
R4479:Olfr1243 UTSW 2 89528170 missense possibly damaging 0.89
R6807:Olfr1243 UTSW 2 89527588 missense probably damaging 1.00
R7025:Olfr1243 UTSW 2 89527604 missense probably damaging 0.98
R7094:Olfr1243 UTSW 2 89527558 missense probably damaging 1.00
R7144:Olfr1243 UTSW 2 89527557 missense probably damaging 1.00
R7972:Olfr1243 UTSW 2 89527604 missense probably benign 0.02
R8013:Olfr1243 UTSW 2 89527936 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGCACAGCATCCCTTGTTAG -3'
(R):5'- GGTCCCAATGTCATTGATCACTTC -3'

Sequencing Primer
(F):5'- GCACAGCATCCCTTGTTAGAATTTAC -3'
(R):5'- CCAATGTCATTGATCACTTCATGTG -3'
Posted On2015-04-17