Incidental Mutation 'R3886:Ccdc73'
ID 309637
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Name coiled-coil domain containing 73
Synonyms 2210415I11Rik
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 104716669-104830082 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104821688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 546 (T546S)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
AlphaFold Q8CDM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000111114
AA Change: T546S

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: T546S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Cd22 T C 7: 30,569,532 (GRCm39) D354G possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gm8674 T C 13: 50,056,199 (GRCm39) noncoding transcript Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcnb2 T C 1: 15,780,639 (GRCm39) S504P probably damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrrk1 C T 7: 65,942,112 (GRCm39) V709I probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Vill A G 9: 118,895,782 (GRCm39) N106S probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104,824,936 (GRCm39) missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104,737,972 (GRCm39) missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104,805,961 (GRCm39) missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104,737,913 (GRCm39) missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
FR4737:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104,782,281 (GRCm39) missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104,811,332 (GRCm39) splice site probably benign
R0040:Ccdc73 UTSW 2 104,822,429 (GRCm39) missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104,759,915 (GRCm39) splice site probably benign
R0360:Ccdc73 UTSW 2 104,811,352 (GRCm39) missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104,821,634 (GRCm39) missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104,803,499 (GRCm39) splice site probably benign
R0839:Ccdc73 UTSW 2 104,821,442 (GRCm39) missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104,822,535 (GRCm39) missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104,821,906 (GRCm39) missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104,745,012 (GRCm39) missense possibly damaging 0.93
R1478:Ccdc73 UTSW 2 104,737,955 (GRCm39) missense possibly damaging 0.72
R1695:Ccdc73 UTSW 2 104,822,450 (GRCm39) missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104,822,637 (GRCm39) missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104,757,280 (GRCm39) missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104,829,504 (GRCm39) missense probably damaging 1.00
R1987:Ccdc73 UTSW 2 104,761,390 (GRCm39) nonsense probably null
R2938:Ccdc73 UTSW 2 104,805,980 (GRCm39) nonsense probably null
R3420:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3420:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3422:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3422:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3522:Ccdc73 UTSW 2 104,821,830 (GRCm39) missense probably damaging 1.00
R4279:Ccdc73 UTSW 2 104,815,355 (GRCm39) missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104,811,450 (GRCm39) splice site probably null
R4793:Ccdc73 UTSW 2 104,848,127 (GRCm39) splice site probably null
R4939:Ccdc73 UTSW 2 104,822,502 (GRCm39) splice site probably null
R4950:Ccdc73 UTSW 2 104,822,711 (GRCm39) missense probably benign
R5093:Ccdc73 UTSW 2 104,848,111 (GRCm39) utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104,822,384 (GRCm39) missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104,820,270 (GRCm39) missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104,761,331 (GRCm39) missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104,822,482 (GRCm39) missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104,737,978 (GRCm39) missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104,822,433 (GRCm39) missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104,821,869 (GRCm39) nonsense probably null
R7062:Ccdc73 UTSW 2 104,782,223 (GRCm39) missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104,803,569 (GRCm39) missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104,829,521 (GRCm39) missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104,782,214 (GRCm39) missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104,824,915 (GRCm39) missense
R7747:Ccdc73 UTSW 2 104,759,901 (GRCm39) missense probably damaging 1.00
R7952:Ccdc73 UTSW 2 104,775,801 (GRCm39) critical splice donor site probably null
R8178:Ccdc73 UTSW 2 104,821,557 (GRCm39) missense probably benign 0.00
R8824:Ccdc73 UTSW 2 104,822,222 (GRCm39) missense possibly damaging 0.74
R8927:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8928:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8945:Ccdc73 UTSW 2 104,821,712 (GRCm39) missense probably benign 0.03
R9365:Ccdc73 UTSW 2 104,738,011 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104,822,584 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAATGTCCCCACACAGAGTC -3'
(R):5'- GGTAGCATTTTCCAGATCTGCTG -3'

Sequencing Primer
(F):5'- GAGTCCTTTGCCTAGATAAAGATGC -3'
(R):5'- CAGATCTGCTGGAAGTAATTTGG -3'
Posted On 2015-04-17