Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Tti1'

309638

Institutional Source

Beutler Lab

Gene Symbol

Tti1

Ensembl Gene

ENSMUSG00000027650

Gene Name

TELO2 interacting protein 1

Synonyms

2610036D13Rik

MMRRC Submission

040798-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

157981803-158028433 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158008950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 123 (V123A)

Ref Sequence

ENSEMBL: ENSMUSP00000116592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029179] [ENSMUST00000109522] [ENSMUST00000124338]

AlphaFold

Q91V83

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029179
AA Change: V123A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029179
Gene: ENSMUSG00000027650
AA Change: V123A

Domain	Start	End	E-Value	Type
low complexity region	89	101	N/A	INTRINSIC
low complexity region	175	189	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	306	319	N/A	INTRINSIC
low complexity region	401	411	N/A	INTRINSIC
low complexity region	494	504	N/A	INTRINSIC
low complexity region	752	768	N/A	INTRINSIC
SCOP:d1gw5a_	855	1044	3e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109522
AA Change: V123A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105148
Gene: ENSMUSG00000027650
AA Change: V123A

Domain	Start	End	E-Value	Type
low complexity region	89	101	N/A	INTRINSIC
low complexity region	175	189	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	306	319	N/A	INTRINSIC
low complexity region	401	411	N/A	INTRINSIC
low complexity region	494	504	N/A	INTRINSIC
low complexity region	752	768	N/A	INTRINSIC
SCOP:d1gw5a_	855	1044	3e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124338
AA Change: V123A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000116592
Gene: ENSMUSG00000027650
AA Change: V123A

Domain	Start	End	E-Value	Type
low complexity region	89	101	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126541

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Cd22	T	C	7: 30,870,107	D354G	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dennd1a	T	C	2: 37,858,077	N376S	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcnb2	T	C	1: 15,710,415	S504P	probably damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrrk1	C	T	7: 66,292,364	V709I	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ppp1r3a	A	C	6: 14,719,912	D334E	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het
Vill	A	G	9: 119,066,714	N106S	probably benign	Het

Other mutations in Tti1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Tti1	APN	2	158008966	missense	probably damaging	1.00
IGL00434:Tti1	APN	2	158008965	missense	probably damaging	1.00
IGL00820:Tti1	APN	2	158008968	missense	probably damaging	1.00
IGL00949:Tti1	APN	2	157982399	missense	probably benign	0.00
IGL01080:Tti1	APN	2	157982459	missense	probably damaging	1.00
IGL01084:Tti1	APN	2	157982459	missense	probably damaging	1.00
IGL01339:Tti1	APN	2	158009130	missense	possibly damaging	0.80
IGL01685:Tti1	APN	2	158000785	missense	probably benign	0.01
IGL01866:Tti1	APN	2	158007698	missense	probably benign	0.27
IGL01903:Tti1	APN	2	158000622	missense	probably benign	0.01
IGL03142:Tti1	APN	2	158000677	missense	probably damaging	0.99
IGL03173:Tti1	APN	2	158007012	unclassified	probably benign
IGL03385:Tti1	APN	2	157993025	missense	possibly damaging	0.86
R0413:Tti1	UTSW	2	157995476	missense	probably benign	0.00
R0601:Tti1	UTSW	2	157993372	missense	probably damaging	0.99
R1718:Tti1	UTSW	2	158008224	missense	probably benign	0.40
R1760:Tti1	UTSW	2	157993035	missense	possibly damaging	0.87
R1761:Tti1	UTSW	2	158007697	missense	probably benign	0.01
R1968:Tti1	UTSW	2	158009046	missense	possibly damaging	0.66
R2054:Tti1	UTSW	2	158007445	missense	possibly damaging	0.79
R2131:Tti1	UTSW	2	158000743	missense	probably benign
R4479:Tti1	UTSW	2	158008395	missense	possibly damaging	0.95
R4647:Tti1	UTSW	2	158007020	unclassified	probably benign
R5124:Tti1	UTSW	2	158008195	missense	probably damaging	0.99
R5145:Tti1	UTSW	2	158008512	missense	probably benign	0.30
R5852:Tti1	UTSW	2	158000673	missense	probably damaging	1.00
R6667:Tti1	UTSW	2	158008427	nonsense	probably null
R6714:Tti1	UTSW	2	158007051	missense	possibly damaging	0.73
R6719:Tti1	UTSW	2	157982300	missense	probably benign	0.01
R7143:Tti1	UTSW	2	158007676	missense	probably benign
R7490:Tti1	UTSW	2	157995472	missense	probably damaging	1.00
R7540:Tti1	UTSW	2	158007996	missense	probably benign	0.43
R7549:Tti1	UTSW	2	158007168	missense	probably damaging	1.00
R7641:Tti1	UTSW	2	158009029	missense	possibly damaging	0.92
R7654:Tti1	UTSW	2	158008554	missense	probably benign	0.00
R7716:Tti1	UTSW	2	158000698	missense	probably benign	0.43
R7722:Tti1	UTSW	2	158007607	missense	probably benign	0.00
R7898:Tti1	UTSW	2	157993470	missense	probably benign	0.00
R8117:Tti1	UTSW	2	158007498	missense	probably damaging	1.00
R8145:Tti1	UTSW	2	158007589	nonsense	probably null
R8249:Tti1	UTSW	2	158000715	missense	probably benign
R8712:Tti1	UTSW	2	157993010	missense	probably damaging	1.00
R8784:Tti1	UTSW	2	158008594	missense	probably benign	0.02
R8912:Tti1	UTSW	2	158009268	missense	probably benign	0.00
R9352:Tti1	UTSW	2	158000772	missense	probably benign	0.00
R9725:Tti1	UTSW	2	158007384	missense	probably benign	0.13
Z1176:Tti1	UTSW	2	157982429	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACAATCACACTGAAGGAGG -3'
(R):5'- TTTGCGATTTGCCCTGAAGAC -3'

Sequencing Primer
(F):5'- GGAGAACCTGCAGACACTG -3'
(R):5'- GATTTGCCCTGAAGACCCCAG -3'

Posted On

2015-04-17