Incidental Mutation 'R3886:Foxd2'
ID 309643
Institutional Source Beutler Lab
Gene Symbol Foxd2
Ensembl Gene ENSMUSG00000055210
Gene Name forkhead box D2
Synonyms Mf2
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.404) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 114906282-114908873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114908286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 179 (H179R)
Ref Sequence ENSEMBL: ENSMUSP00000066868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068654]
AlphaFold O35392
Predicted Effect unknown
Transcript: ENSMUST00000068654
AA Change: H179R
SMART Domains Protein: ENSMUSP00000066868
Gene: ENSMUSG00000055210
AA Change: H179R

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 82 126 N/A INTRINSIC
FH 127 217 1.01e-60 SMART
low complexity region 229 259 N/A INTRINSIC
low complexity region 263 304 N/A INTRINSIC
low complexity region 310 351 N/A INTRINSIC
low complexity region 365 384 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 416 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144002
Meta Mutation Damage Score 0.9067 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit renal abnormalities including kidney hypoplasia and hydroureter. Penetrance is reduced, and dependent upon the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,213 N331S probably benign Het
2410089E03Rik T A 15: 8,171,805 V22E probably damaging Het
4933407L21Rik T A 1: 85,940,551 probably null Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B020004J07Rik T C 4: 101,835,723 K360R probably benign Het
Ccdc73 A T 2: 104,991,343 T546S possibly damaging Het
Cd22 T C 7: 30,870,107 D354G possibly damaging Het
Chchd6 T C 6: 89,467,451 E183G probably damaging Het
Col6a5 A G 9: 105,930,930 L973P unknown Het
Cp T C 3: 19,989,111 L1021P probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
D630045J12Rik A G 6: 38,142,698 V1703A possibly damaging Het
Dennd1a T C 2: 37,858,077 N376S possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Ect2l C T 10: 18,168,458 V310M probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Gm8674 T C 13: 49,902,163 noncoding transcript Het
Ice1 T C 13: 70,605,370 T866A probably benign Het
Jade2 C T 11: 51,830,499 V201I possibly damaging Het
Kcnb2 T C 1: 15,710,415 S504P probably damaging Het
Kcng4 T C 8: 119,633,247 K130R probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrrk1 C T 7: 66,292,364 V709I probably damaging Het
Mdh1 A G 11: 21,559,832 V181A probably damaging Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr978 A G 9: 39,994,539 H243R probably damaging Het
Papd5 C A 8: 88,200,415 A151E probably benign Het
Ppp1r3a A C 6: 14,719,912 D334E possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G A 13: 37,898,506 probably null Het
Slc35f2 T A 9: 53,816,957 S372T probably benign Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Tnxb A G 17: 34,718,911 D3896G probably damaging Het
Tti1 A G 2: 158,008,950 V123A possibly damaging Het
Usp1 T C 4: 98,929,736 C147R probably damaging Het
Vill A G 9: 119,066,714 N106S probably benign Het
Other mutations in Foxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1168:Foxd2 UTSW 4 114907678 missense possibly damaging 0.85
R1183:Foxd2 UTSW 4 114907465 missense possibly damaging 0.68
R1479:Foxd2 UTSW 4 114907918 missense unknown
R3885:Foxd2 UTSW 4 114908286 missense unknown
R3887:Foxd2 UTSW 4 114908286 missense unknown
R3888:Foxd2 UTSW 4 114908286 missense unknown
R3889:Foxd2 UTSW 4 114908286 missense unknown
R4874:Foxd2 UTSW 4 114907571 missense possibly damaging 0.53
R5646:Foxd2 UTSW 4 114908635 missense unknown
R6126:Foxd2 UTSW 4 114908505 missense unknown
R7235:Foxd2 UTSW 4 114908271 missense unknown
R7749:Foxd2 UTSW 4 114907812 missense unknown
R9697:Foxd2 UTSW 4 114908487 missense unknown
R9715:Foxd2 UTSW 4 114907998 missense unknown
R9786:Foxd2 UTSW 4 114907653 missense possibly damaging 0.86
Z1177:Foxd2 UTSW 4 114907887 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAAAGCCTTGGCGCAAC -3'
(R):5'- ACGGAGCCCTCTGGTGAAA -3'

Sequencing Primer
(F):5'- ACTGACAGCTGGCAAGGC -3'
(R):5'- GTGAAACCACCTTATTCGTACATCG -3'
Posted On 2015-04-17