Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Ppp1r3a'

309645

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r3a

Ensembl Gene

ENSMUSG00000042717

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 3A

Synonyms

RGL, GM

MMRRC Submission

040798-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14713977-14755274 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 14719912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 334 (D334E)

Ref Sequence

ENSEMBL: ENSMUSP00000049054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045096]

AlphaFold

Q99MR9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045096
AA Change: D334E

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: D334E

Domain	Start	End	E-Value	Type
low complexity region	37	51	N/A	INTRINSIC
Pfam:CBM_21	124	231	2.3e-32	PFAM
low complexity region	370	381	N/A	INTRINSIC
low complexity region	636	646	N/A	INTRINSIC
low complexity region	952	961	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Cd22	T	C	7: 30,870,107	D354G	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dennd1a	T	C	2: 37,858,077	N376S	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcnb2	T	C	1: 15,710,415	S504P	probably damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrrk1	C	T	7: 66,292,364	V709I	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Tti1	A	G	2: 158,008,950	V123A	possibly damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het
Vill	A	G	9: 119,066,714	N106S	probably benign	Het

Other mutations in Ppp1r3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ppp1r3a	APN	6	14755084	missense	probably damaging	1.00
IGL00670:Ppp1r3a	APN	6	14719060	missense	probably benign	0.22
IGL00703:Ppp1r3a	APN	6	14718408	missense	probably benign	0.02
IGL00726:Ppp1r3a	APN	6	14717852	missense	probably benign	0.42
IGL00742:Ppp1r3a	APN	6	14718609	missense	probably benign	0.36
IGL01477:Ppp1r3a	APN	6	14718346	missense	probably damaging	0.99
IGL01632:Ppp1r3a	APN	6	14754811	missense	probably damaging	1.00
IGL02162:Ppp1r3a	APN	6	14717715	missense	probably damaging	1.00
IGL02374:Ppp1r3a	APN	6	14718600	missense	probably damaging	1.00
IGL02539:Ppp1r3a	APN	6	14718459	missense	probably benign	0.01
IGL02563:Ppp1r3a	APN	6	14719762	missense	probably benign	0.20
IGL02929:Ppp1r3a	APN	6	14719811	missense	probably benign	0.00
IGL03110:Ppp1r3a	APN	6	14722065	splice site	probably benign
IGL03290:Ppp1r3a	APN	6	14754772	missense	probably damaging	1.00
IGL03326:Ppp1r3a	APN	6	14719766	missense	probably damaging	0.96
P0041:Ppp1r3a	UTSW	6	14719697	missense	probably benign	0.00
PIT4445001:Ppp1r3a	UTSW	6	14717777	missense	probably damaging	1.00
R0015:Ppp1r3a	UTSW	6	14717661	missense	possibly damaging	0.58
R0077:Ppp1r3a	UTSW	6	14754517	missense	possibly damaging	0.64
R0368:Ppp1r3a	UTSW	6	14718960	missense	probably benign	0.26
R0391:Ppp1r3a	UTSW	6	14719697	missense	probably benign	0.43
R1793:Ppp1r3a	UTSW	6	14754718	missense	probably damaging	1.00
R1797:Ppp1r3a	UTSW	6	14717982	missense	probably benign	0.02
R1855:Ppp1r3a	UTSW	6	14754994	missense	probably damaging	1.00
R1864:Ppp1r3a	UTSW	6	14718405	missense	probably damaging	1.00
R1865:Ppp1r3a	UTSW	6	14718405	missense	probably damaging	1.00
R2046:Ppp1r3a	UTSW	6	14722104	missense	probably benign	0.12
R2122:Ppp1r3a	UTSW	6	14721875	missense	possibly damaging	0.95
R2437:Ppp1r3a	UTSW	6	14718323	missense	probably benign	0.03
R2518:Ppp1r3a	UTSW	6	14719378	missense	possibly damaging	0.95
R2887:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R2888:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R2889:Ppp1r3a	UTSW	6	14718249	missense	possibly damaging	0.89
R3419:Ppp1r3a	UTSW	6	14719414	missense	probably benign	0.01
R3937:Ppp1r3a	UTSW	6	14719074	missense	probably damaging	0.99
R3938:Ppp1r3a	UTSW	6	14719074	missense	probably damaging	0.99
R4246:Ppp1r3a	UTSW	6	14719781	missense	probably damaging	1.00
R4561:Ppp1r3a	UTSW	6	14754682	missense	probably damaging	1.00
R4701:Ppp1r3a	UTSW	6	14718993	missense	probably benign	0.00
R4853:Ppp1r3a	UTSW	6	14719047	missense	probably benign	0.03
R5076:Ppp1r3a	UTSW	6	14754681	missense	probably damaging	1.00
R5085:Ppp1r3a	UTSW	6	14719604	missense	probably damaging	1.00
R5501:Ppp1r3a	UTSW	6	14719418	missense	probably benign	0.02
R5725:Ppp1r3a	UTSW	6	14719349	missense	probably benign	0.04
R5729:Ppp1r3a	UTSW	6	14719763	missense	probably benign	0.06
R5741:Ppp1r3a	UTSW	6	14719883	missense	probably damaging	0.97
R5841:Ppp1r3a	UTSW	6	14718984	missense	probably benign	0.26
R5914:Ppp1r3a	UTSW	6	14718989	missense	probably benign	0.09
R6091:Ppp1r3a	UTSW	6	14719340	missense	probably benign	0.02
R6154:Ppp1r3a	UTSW	6	14754604	missense	possibly damaging	0.88
R6218:Ppp1r3a	UTSW	6	14718431	missense	probably damaging	0.99
R6813:Ppp1r3a	UTSW	6	14719571	missense	probably benign	0.13
R6826:Ppp1r3a	UTSW	6	14718981	nonsense	probably null
R6869:Ppp1r3a	UTSW	6	14754826	missense	probably benign	0.39
R7109:Ppp1r3a	UTSW	6	14719236	missense	probably benign	0.00
R7188:Ppp1r3a	UTSW	6	14719191	missense	probably benign	0.00
R7262:Ppp1r3a	UTSW	6	14719070	missense	probably benign	0.04
R7341:Ppp1r3a	UTSW	6	14718750	missense	probably damaging	0.97
R7770:Ppp1r3a	UTSW	6	14754978	missense	probably benign	0.06
R7856:Ppp1r3a	UTSW	6	14718026	missense	probably benign	0.01
R8309:Ppp1r3a	UTSW	6	14719701	missense	probably benign	0.02
R8422:Ppp1r3a	UTSW	6	14718435	nonsense	probably null
R8868:Ppp1r3a	UTSW	6	14755015	missense	probably damaging	1.00
R9039:Ppp1r3a	UTSW	6	14754526	missense	probably damaging	1.00
R9149:Ppp1r3a	UTSW	6	14722099	missense	probably benign	0.32
R9302:Ppp1r3a	UTSW	6	14721892	missense	probably benign	0.00
R9399:Ppp1r3a	UTSW	6	14755011	missense	probably damaging	0.99
R9565:Ppp1r3a	UTSW	6	14719467	missense	probably benign	0.02
R9730:Ppp1r3a	UTSW	6	14721924	missense	probably benign	0.25
R9767:Ppp1r3a	UTSW	6	14718102	missense	probably benign	0.03
R9782:Ppp1r3a	UTSW	6	14718767	missense	probably damaging	1.00
Z1177:Ppp1r3a	UTSW	6	14755151	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- TGGGGAAGAACTTCTGCTATG -3'
(R):5'- GGAGTGTGATTAATTTGGCCCC -3'

Sequencing Primer
(F):5'- CTTCTGCTATGATAGAAATCTCGC -3'
(R):5'- CCAAACATCCAACTTCTAGAGTTTG -3'

Posted On

2015-04-17