Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Cd22'

309650

Institutional Source

Beutler Lab

Gene Symbol

Cd22

Ensembl Gene

ENSMUSG00000030577

Gene Name

CD22 antigen

Synonyms

Lyb-8, Lyb8

MMRRC Submission

040798-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30865402-30880342 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30870107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 354 (D354G)

Ref Sequence

ENSEMBL: ENSMUSP00000150025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000019248
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: D528G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108125
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: D528G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186154
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: D528G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187989

Predicted Effect

probably benign
Transcript: ENSMUST00000189718
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: D528G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189996

Predicted Effect

probably benign
Transcript: ENSMUST00000190455

Predicted Effect

probably benign
Transcript: ENSMUST00000190617
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: D528G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	2.75e-1	SMART
IG_like	156	254	4.07e1	SMART
IGc2	269	337	2.68e-4	SMART
IGc2	365	424	4.52e-11	SMART
IG	448	523	1.21e-2	SMART
IGc2	541	599	6.75e-10	SMART
IGc2	628	687	2.68e-4	SMART
transmembrane domain	709	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190646

SMART Domains

Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	31	147	1.1e-3	SMART
IG_like	166	245	1.6e-2	SMART
IGc2	269	337	1.1e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214289
AA Change: D354G

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dennd1a	T	C	2: 37,858,077	N376S	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcnb2	T	C	1: 15,710,415	S504P	probably damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrrk1	C	T	7: 66,292,364	V709I	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ppp1r3a	A	C	6: 14,719,912	D334E	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Tti1	A	G	2: 158,008,950	V123A	possibly damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het
Vill	A	G	9: 119,066,714	N106S	probably benign	Het

Other mutations in Cd22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00714:Cd22	APN	7	30876147	missense	probably benign	0.01
IGL02236:Cd22	APN	7	30867468	missense	possibly damaging	0.54
IGL02321:Cd22	APN	7	30869883	missense	probably damaging	1.00
IGL02335:Cd22	APN	7	30876134	missense	probably damaging	1.00
IGL02397:Cd22	APN	7	30877625	missense	probably benign
IGL02402:Cd22	APN	7	30877530	missense	possibly damaging	0.86
IGL02538:Cd22	APN	7	30877560	missense	probably benign	0.40
IGL02736:Cd22	APN	7	30878045	splice site	probably null
blitz	UTSW	7	30869904	missense	probably damaging	1.00
crullers	UTSW	7	30869883	missense	probably damaging	1.00
gansu	UTSW	7	30870105	missense	probably damaging	1.00
lacrima	UTSW	7	30876153	missense	probably damaging	1.00
Lluvia	UTSW	7	30870487	missense	possibly damaging	0.48
Mist	UTSW	7	30866658	missense	probably damaging	1.00
rain	UTSW	7	30877534	missense	probably damaging	1.00
well	UTSW	7	30877787	nonsense	probably null
Yosemite	UTSW	7	30869509	critical splice donor site	probably null
FR4304:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
FR4340:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
FR4342:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
FR4589:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
LCD18:Cd22	UTSW	7	30878082	missense	possibly damaging	0.95
PIT4142001:Cd22	UTSW	7	30877799	missense	possibly damaging	0.92
R0123:Cd22	UTSW	7	30867108	splice site	probably benign
R0130:Cd22	UTSW	7	30869964	missense	possibly damaging	0.92
R0926:Cd22	UTSW	7	30869509	critical splice donor site	probably null
R1245:Cd22	UTSW	7	30869883	missense	probably damaging	1.00
R1332:Cd22	UTSW	7	30870487	missense	possibly damaging	0.48
R1457:Cd22	UTSW	7	30873170	missense	probably benign	0.07
R1716:Cd22	UTSW	7	30877678	missense	probably damaging	1.00
R1980:Cd22	UTSW	7	30873233	missense	probably damaging	1.00
R2017:Cd22	UTSW	7	30872780	missense	probably damaging	0.99
R2061:Cd22	UTSW	7	30870105	missense	probably damaging	1.00
R2061:Cd22	UTSW	7	30876156	missense	probably benign	0.03
R2075:Cd22	UTSW	7	30869698	missense	probably damaging	1.00
R2216:Cd22	UTSW	7	30867046	missense	probably damaging	1.00
R4599:Cd22	UTSW	7	30875900	missense	probably damaging	0.98
R4701:Cd22	UTSW	7	30876153	missense	probably damaging	1.00
R4796:Cd22	UTSW	7	30872956	splice site	probably null
R5179:Cd22	UTSW	7	30875874	missense	possibly damaging	0.81
R5233:Cd22	UTSW	7	30877534	missense	probably damaging	1.00
R5456:Cd22	UTSW	7	30876039	missense	probably benign	0.02
R5511:Cd22	UTSW	7	30870071	missense	probably damaging	1.00
R5513:Cd22	UTSW	7	30867025	missense	probably damaging	0.99
R5611:Cd22	UTSW	7	30878150	unclassified	probably benign
R5656:Cd22	UTSW	7	30869773	missense	probably damaging	1.00
R5966:Cd22	UTSW	7	30866658	missense	probably damaging	1.00
R6329:Cd22	UTSW	7	30877768	missense	probably damaging	0.99
R6356:Cd22	UTSW	7	30877702	missense	probably damaging	1.00
R6455:Cd22	UTSW	7	30876153	missense	probably damaging	1.00
R6550:Cd22	UTSW	7	30877552	missense	probably benign	0.00
R6656:Cd22	UTSW	7	30877757	missense	probably benign	0.11
R6688:Cd22	UTSW	7	30872964	missense	possibly damaging	0.91
R6844:Cd22	UTSW	7	30873431	splice site	probably null
R6957:Cd22	UTSW	7	30867574	missense	possibly damaging	0.88
R7068:Cd22	UTSW	7	30878079	missense	probably benign	0.03
R7083:Cd22	UTSW	7	30868048	missense	probably damaging	0.99
R7225:Cd22	UTSW	7	30877634	missense	not run
R7732:Cd22	UTSW	7	30870057	missense	probably damaging	1.00
R8686:Cd22	UTSW	7	30870069	missense	probably benign	0.03
R8851:Cd22	UTSW	7	30877659	missense	probably benign	0.01
R8987:Cd22	UTSW	7	30877747	missense	probably damaging	1.00
R9051:Cd22	UTSW	7	30876024	missense	probably benign
R9098:Cd22	UTSW	7	30867966	missense	probably benign	0.00
R9124:Cd22	UTSW	7	30873237	missense	probably benign	0.01
R9167:Cd22	UTSW	7	30876005	missense	probably benign	0.07
R9319:Cd22	UTSW	7	30869904	missense	probably damaging	1.00
R9369:Cd22	UTSW	7	30877574	missense	probably benign	0.09
X0025:Cd22	UTSW	7	30873419	splice site	probably null
Z1176:Cd22	UTSW	7	30867963	missense	probably benign	0.03
Z1176:Cd22	UTSW	7	30869530	missense	probably damaging	1.00
Z1186:Cd22	UTSW	7	30867053	missense	probably benign	0.01
Z1186:Cd22	UTSW	7	30867466	missense	probably benign
Z1186:Cd22	UTSW	7	30875867	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GATGGAGTTGTTGACCATGCAG -3'
(R):5'- AGGTCACATTGAGATCTGTGGG -3'

Sequencing Primer
(F):5'- GTTGACCATGCAGTTATAATTTCCAG -3'
(R):5'- CACATTGAGATCTGTGGGTGGGAG -3'

Posted On

2015-04-17