Incidental Mutation 'R3886:Cd22'
ID 309650
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene Name CD22 antigen
Synonyms Lyb8, Lyb-8
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30564829-30579767 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30569532 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 354 (D354G)
Ref Sequence ENSEMBL: ENSMUSP00000150025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019248
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108125
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186154
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably benign
Transcript: ENSMUST00000189718
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Predicted Effect probably benign
Transcript: ENSMUST00000190617
AA Change: D528G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: D528G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190646
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214289
AA Change: D354G

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ccdc73 A T 2: 104,821,688 (GRCm39) T546S possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gm8674 T C 13: 50,056,199 (GRCm39) noncoding transcript Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcnb2 T C 1: 15,780,639 (GRCm39) S504P probably damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrrk1 C T 7: 65,942,112 (GRCm39) V709I probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Vill A G 9: 118,895,782 (GRCm39) N106S probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30,575,572 (GRCm39) missense probably benign 0.01
IGL02236:Cd22 APN 7 30,566,893 (GRCm39) missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30,569,308 (GRCm39) missense probably damaging 1.00
IGL02335:Cd22 APN 7 30,575,559 (GRCm39) missense probably damaging 1.00
IGL02397:Cd22 APN 7 30,577,050 (GRCm39) missense probably benign
IGL02402:Cd22 APN 7 30,576,955 (GRCm39) missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30,576,985 (GRCm39) missense probably benign 0.40
IGL02736:Cd22 APN 7 30,577,470 (GRCm39) splice site probably null
blitz UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
crullers UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
gansu UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
lacrima UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
Lluvia UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
Mist UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
rain UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
well UTSW 7 30,577,212 (GRCm39) nonsense probably null
Yosemite UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
FR4304:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30,577,224 (GRCm39) missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30,566,533 (GRCm39) splice site probably benign
R0130:Cd22 UTSW 7 30,569,389 (GRCm39) missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
R1245:Cd22 UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
R1332:Cd22 UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30,572,595 (GRCm39) missense probably benign 0.07
R1716:Cd22 UTSW 7 30,577,103 (GRCm39) missense probably damaging 1.00
R1980:Cd22 UTSW 7 30,572,658 (GRCm39) missense probably damaging 1.00
R2017:Cd22 UTSW 7 30,572,205 (GRCm39) missense probably damaging 0.99
R2061:Cd22 UTSW 7 30,575,581 (GRCm39) missense probably benign 0.03
R2061:Cd22 UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
R2075:Cd22 UTSW 7 30,569,123 (GRCm39) missense probably damaging 1.00
R2216:Cd22 UTSW 7 30,566,471 (GRCm39) missense probably damaging 1.00
R4599:Cd22 UTSW 7 30,575,325 (GRCm39) missense probably damaging 0.98
R4701:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R4796:Cd22 UTSW 7 30,572,381 (GRCm39) splice site probably null
R5179:Cd22 UTSW 7 30,575,299 (GRCm39) missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
R5456:Cd22 UTSW 7 30,575,464 (GRCm39) missense probably benign 0.02
R5511:Cd22 UTSW 7 30,569,496 (GRCm39) missense probably damaging 1.00
R5513:Cd22 UTSW 7 30,566,450 (GRCm39) missense probably damaging 0.99
R5611:Cd22 UTSW 7 30,577,575 (GRCm39) unclassified probably benign
R5656:Cd22 UTSW 7 30,569,198 (GRCm39) missense probably damaging 1.00
R5966:Cd22 UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
R6329:Cd22 UTSW 7 30,577,193 (GRCm39) missense probably damaging 0.99
R6356:Cd22 UTSW 7 30,577,127 (GRCm39) missense probably damaging 1.00
R6455:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R6550:Cd22 UTSW 7 30,576,977 (GRCm39) missense probably benign 0.00
R6656:Cd22 UTSW 7 30,577,182 (GRCm39) missense probably benign 0.11
R6688:Cd22 UTSW 7 30,572,389 (GRCm39) missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30,572,856 (GRCm39) splice site probably null
R6957:Cd22 UTSW 7 30,566,999 (GRCm39) missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30,577,504 (GRCm39) missense probably benign 0.03
R7083:Cd22 UTSW 7 30,567,473 (GRCm39) missense probably damaging 0.99
R7225:Cd22 UTSW 7 30,577,059 (GRCm39) missense not run
R7732:Cd22 UTSW 7 30,569,482 (GRCm39) missense probably damaging 1.00
R8686:Cd22 UTSW 7 30,569,494 (GRCm39) missense probably benign 0.03
R8851:Cd22 UTSW 7 30,577,084 (GRCm39) missense probably benign 0.01
R8987:Cd22 UTSW 7 30,577,172 (GRCm39) missense probably damaging 1.00
R9051:Cd22 UTSW 7 30,575,449 (GRCm39) missense probably benign
R9098:Cd22 UTSW 7 30,567,391 (GRCm39) missense probably benign 0.00
R9124:Cd22 UTSW 7 30,572,662 (GRCm39) missense probably benign 0.01
R9167:Cd22 UTSW 7 30,575,430 (GRCm39) missense probably benign 0.07
R9319:Cd22 UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
R9369:Cd22 UTSW 7 30,576,999 (GRCm39) missense probably benign 0.09
X0025:Cd22 UTSW 7 30,572,844 (GRCm39) splice site probably null
Z1176:Cd22 UTSW 7 30,568,955 (GRCm39) missense probably damaging 1.00
Z1176:Cd22 UTSW 7 30,567,388 (GRCm39) missense probably benign 0.03
Z1186:Cd22 UTSW 7 30,566,891 (GRCm39) missense probably benign
Z1186:Cd22 UTSW 7 30,566,478 (GRCm39) missense probably benign 0.01
Z1186:Cd22 UTSW 7 30,575,292 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATGGAGTTGTTGACCATGCAG -3'
(R):5'- AGGTCACATTGAGATCTGTGGG -3'

Sequencing Primer
(F):5'- GTTGACCATGCAGTTATAATTTCCAG -3'
(R):5'- CACATTGAGATCTGTGGGTGGGAG -3'
Posted On 2015-04-17