Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Lrrk1'

309651

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

040798-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66292364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 709 (V709I)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000015277
AA Change: V709I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: V709I

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Cd22	T	C	7: 30,870,107	D354G	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dennd1a	T	C	2: 37,858,077	N376S	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcnb2	T	C	1: 15,710,415	S504P	probably damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ppp1r3a	A	C	6: 14,719,912	D334E	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Tti1	A	G	2: 158,008,950	V123A	possibly damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het
Vill	A	G	9: 119,066,714	N106S	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTCAGACCACAGAACCGTGG -3'
(R):5'- TCTACCTTTGTGCCACTGGG -3'

Sequencing Primer
(F):5'- ACAGAACCGTGGCATGCTG -3'
(R):5'- TTCCTAAGACACACTGGAGTCTG -3'

Posted On

2015-04-17