Incidental Mutation 'R3886:Lrrk1'
ID 309651
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Name leucine-rich repeat kinase 1
Synonyms D130026O16Rik, C230002E15Rik
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 65908493-66038089 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65942112 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 709 (V709I)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277]
AlphaFold Q3UHC2
Predicted Effect probably damaging
Transcript: ENSMUST00000015277
AA Change: V709I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: V709I

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ccdc73 A T 2: 104,821,688 (GRCm39) T546S possibly damaging Het
Cd22 T C 7: 30,569,532 (GRCm39) D354G possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gm8674 T C 13: 50,056,199 (GRCm39) noncoding transcript Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcnb2 T C 1: 15,780,639 (GRCm39) S504P probably damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Vill A G 9: 118,895,782 (GRCm39) N106S probably benign Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 65,937,449 (GRCm39) missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 65,915,198 (GRCm39) missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 65,929,164 (GRCm39) missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 65,958,407 (GRCm39) critical splice donor site probably null
IGL02679:Lrrk1 APN 7 65,924,620 (GRCm39) missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 65,980,515 (GRCm39) missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 65,958,439 (GRCm39) missense probably benign 0.12
IGL02878:Lrrk1 APN 7 65,912,311 (GRCm39) missense probably benign
IGL03135:Lrrk1 APN 7 65,912,638 (GRCm39) missense probably benign 0.00
IGL03191:Lrrk1 APN 7 65,909,707 (GRCm39) missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 65,956,642 (GRCm39) missense probably damaging 1.00
combustion UTSW 7 65,912,413 (GRCm39) missense possibly damaging 0.94
fluorine UTSW 7 65,952,458 (GRCm39) missense possibly damaging 0.89
halide UTSW 7 65,915,222 (GRCm39) missense possibly damaging 0.82
Heiland UTSW 7 65,912,481 (GRCm39) missense probably damaging 0.96
liebster UTSW 7 65,944,729 (GRCm39) missense probably damaging 1.00
magi UTSW 7 65,931,396 (GRCm39) missense probably damaging 1.00
oxidation UTSW 7 65,929,120 (GRCm39) missense probably benign 0.00
phlogiston UTSW 7 65,928,268 (GRCm39) splice site probably benign
Savior UTSW 7 65,912,235 (GRCm39) missense probably damaging 1.00
wenig UTSW 7 65,922,749 (GRCm39) missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 65,942,089 (GRCm39) missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 65,942,089 (GRCm39) missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 65,946,011 (GRCm39) splice site probably benign
R0505:Lrrk1 UTSW 7 65,940,656 (GRCm39) splice site probably null
R0609:Lrrk1 UTSW 7 65,916,363 (GRCm39) splice site probably null
R0650:Lrrk1 UTSW 7 65,942,084 (GRCm39) missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 65,944,729 (GRCm39) missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 65,912,031 (GRCm39) missense probably benign 0.00
R1435:Lrrk1 UTSW 7 65,922,776 (GRCm39) missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 65,909,722 (GRCm39) missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 65,909,722 (GRCm39) missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 65,952,419 (GRCm39) nonsense probably null
R1620:Lrrk1 UTSW 7 66,031,286 (GRCm39) missense probably benign 0.00
R1884:Lrrk1 UTSW 7 65,912,185 (GRCm39) missense probably benign
R1891:Lrrk1 UTSW 7 65,929,048 (GRCm39) missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 65,931,432 (GRCm39) missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 65,929,030 (GRCm39) missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 65,980,498 (GRCm39) missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 65,945,911 (GRCm39) missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 65,935,159 (GRCm39) splice site probably null
R3176:Lrrk1 UTSW 7 65,955,269 (GRCm39) missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 65,955,269 (GRCm39) missense possibly damaging 0.69
R3893:Lrrk1 UTSW 7 65,928,268 (GRCm39) splice site probably benign
R3906:Lrrk1 UTSW 7 65,944,651 (GRCm39) missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 65,980,512 (GRCm39) missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 65,922,801 (GRCm39) missense probably benign 0.12
R4653:Lrrk1 UTSW 7 65,922,801 (GRCm39) missense probably benign 0.12
R4672:Lrrk1 UTSW 7 65,929,120 (GRCm39) missense probably benign 0.00
R4693:Lrrk1 UTSW 7 65,912,235 (GRCm39) missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 65,912,041 (GRCm39) missense probably benign
R4737:Lrrk1 UTSW 7 65,956,621 (GRCm39) missense probably benign 0.09
R4795:Lrrk1 UTSW 7 65,912,413 (GRCm39) missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 65,945,202 (GRCm39) missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 65,982,111 (GRCm39) missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 65,956,855 (GRCm39) missense probably benign 0.00
R5407:Lrrk1 UTSW 7 65,920,545 (GRCm39) missense probably benign 0.20
R5482:Lrrk1 UTSW 7 65,980,418 (GRCm39) missense probably benign
R5600:Lrrk1 UTSW 7 65,956,963 (GRCm39) missense probably benign 0.31
R5615:Lrrk1 UTSW 7 65,937,363 (GRCm39) missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 65,911,881 (GRCm39) missense probably benign
R6211:Lrrk1 UTSW 7 65,952,458 (GRCm39) missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 65,956,851 (GRCm39) critical splice donor site probably null
R6276:Lrrk1 UTSW 7 65,956,587 (GRCm39) splice site probably null
R6447:Lrrk1 UTSW 7 65,952,476 (GRCm39) missense probably benign 0.19
R6478:Lrrk1 UTSW 7 65,912,481 (GRCm39) missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 65,931,396 (GRCm39) missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 65,922,749 (GRCm39) missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 65,992,527 (GRCm39) missense probably benign 0.05
R6995:Lrrk1 UTSW 7 65,942,090 (GRCm39) missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 65,937,191 (GRCm39) missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 65,935,027 (GRCm39) missense probably benign 0.06
R7203:Lrrk1 UTSW 7 65,920,573 (GRCm39) missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 65,982,134 (GRCm39) missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 65,911,903 (GRCm39) missense probably benign
R7440:Lrrk1 UTSW 7 65,940,602 (GRCm39) missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 65,912,310 (GRCm39) missense probably benign
R7593:Lrrk1 UTSW 7 65,958,439 (GRCm39) missense probably benign 0.12
R7728:Lrrk1 UTSW 7 65,912,463 (GRCm39) missense probably benign 0.00
R7984:Lrrk1 UTSW 7 65,950,477 (GRCm39) splice site probably null
R7993:Lrrk1 UTSW 7 65,912,202 (GRCm39) missense probably benign 0.00
R8009:Lrrk1 UTSW 7 65,915,222 (GRCm39) missense possibly damaging 0.82
R8037:Lrrk1 UTSW 7 65,935,089 (GRCm39) missense probably benign
R8101:Lrrk1 UTSW 7 65,992,530 (GRCm39) missense probably benign
R8116:Lrrk1 UTSW 7 65,912,371 (GRCm39) missense possibly damaging 0.95
R8126:Lrrk1 UTSW 7 65,942,063 (GRCm39) missense probably damaging 1.00
R8278:Lrrk1 UTSW 7 65,928,432 (GRCm39) missense probably benign 0.37
R8559:Lrrk1 UTSW 7 65,932,075 (GRCm39) missense possibly damaging 0.48
R8669:Lrrk1 UTSW 7 65,912,344 (GRCm39) missense probably benign 0.20
R8690:Lrrk1 UTSW 7 65,952,477 (GRCm39) missense probably benign 0.02
R8955:Lrrk1 UTSW 7 65,919,573 (GRCm39) missense probably benign 0.09
R9135:Lrrk1 UTSW 7 65,928,357 (GRCm39) missense probably damaging 1.00
R9380:Lrrk1 UTSW 7 65,928,331 (GRCm39) missense probably damaging 1.00
R9625:Lrrk1 UTSW 7 65,909,666 (GRCm39) makesense probably null
R9721:Lrrk1 UTSW 7 65,924,623 (GRCm39) missense probably damaging 1.00
RF018:Lrrk1 UTSW 7 66,031,250 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCAGACCACAGAACCGTGG -3'
(R):5'- TCTACCTTTGTGCCACTGGG -3'

Sequencing Primer
(F):5'- ACAGAACCGTGGCATGCTG -3'
(R):5'- TTCCTAAGACACACTGGAGTCTG -3'
Posted On 2015-04-17