Incidental Mutation 'R3886:Robo3'
ID 309654
Institutional Source Beutler Lab
Gene Symbol Robo3
Ensembl Gene ENSMUSG00000032128
Gene Name roundabout guidance receptor 3
Synonyms Rig1, Rig-1, Robo3b, Robo3a, Rbig1
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 37415669-37433246 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 37422181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 723 (Q723*)
Ref Sequence ENSEMBL: ENSMUSP00000150639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000115038] [ENSMUST00000170512]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000034643
AA Change: Q723*
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128
AA Change: Q723*

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115038
AA Change: Q745*
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128
AA Change: Q745*

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167216
Predicted Effect probably null
Transcript: ENSMUST00000170512
AA Change: Q723*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal commissural axon growth, and fragile floor plates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,213 N331S probably benign Het
2410089E03Rik T A 15: 8,171,805 V22E probably damaging Het
4933407L21Rik T A 1: 85,940,551 probably null Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B020004J07Rik T C 4: 101,835,723 K360R probably benign Het
Ccdc73 A T 2: 104,991,343 T546S possibly damaging Het
Cd22 T C 7: 30,870,107 D354G possibly damaging Het
Chchd6 T C 6: 89,467,451 E183G probably damaging Het
Col6a5 A G 9: 105,930,930 L973P unknown Het
Cp T C 3: 19,989,111 L1021P probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
D630045J12Rik A G 6: 38,142,698 V1703A possibly damaging Het
Dennd1a T C 2: 37,858,077 N376S possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Ect2l C T 10: 18,168,458 V310M probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gm8674 T C 13: 49,902,163 noncoding transcript Het
Ice1 T C 13: 70,605,370 T866A probably benign Het
Jade2 C T 11: 51,830,499 V201I possibly damaging Het
Kcnb2 T C 1: 15,710,415 S504P probably damaging Het
Kcng4 T C 8: 119,633,247 K130R probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrrk1 C T 7: 66,292,364 V709I probably damaging Het
Mdh1 A G 11: 21,559,832 V181A probably damaging Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr978 A G 9: 39,994,539 H243R probably damaging Het
Papd5 C A 8: 88,200,415 A151E probably benign Het
Ppp1r3a A C 6: 14,719,912 D334E possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Rreb1 G A 13: 37,898,506 probably null Het
Slc35f2 T A 9: 53,816,957 S372T probably benign Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Tnxb A G 17: 34,718,911 D3896G probably damaging Het
Tti1 A G 2: 158,008,950 V123A possibly damaging Het
Usp1 T C 4: 98,929,736 C147R probably damaging Het
Vill A G 9: 119,066,714 N106S probably benign Het
Other mutations in Robo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Robo3 APN 9 37427754 critical splice donor site probably null
IGL01023:Robo3 APN 9 37429551 missense probably damaging 1.00
IGL01431:Robo3 APN 9 37419111 unclassified probably benign
IGL01993:Robo3 APN 9 37424653 missense probably damaging 1.00
IGL02256:Robo3 APN 9 37425353 missense probably damaging 1.00
IGL02323:Robo3 APN 9 37422201 missense probably benign 0.05
IGL02561:Robo3 APN 9 37427091 missense possibly damaging 0.84
IGL02866:Robo3 APN 9 37422306 missense possibly damaging 0.89
IGL02897:Robo3 APN 9 37427502 nonsense probably null
IGL03003:Robo3 APN 9 37419291 missense probably damaging 1.00
IGL03307:Robo3 APN 9 37422564 missense probably damaging 0.96
IGL03097:Robo3 UTSW 9 37422528 critical splice donor site probably null
R0137:Robo3 UTSW 9 37425344 missense probably benign 0.00
R0266:Robo3 UTSW 9 37422640 missense probably damaging 0.96
R0390:Robo3 UTSW 9 37422177 missense probably benign 0.00
R0505:Robo3 UTSW 9 37416759 unclassified probably benign
R0815:Robo3 UTSW 9 37422183 missense probably damaging 1.00
R0924:Robo3 UTSW 9 37429482 splice site probably benign
R1167:Robo3 UTSW 9 37423907 nonsense probably null
R1203:Robo3 UTSW 9 37418682 missense probably damaging 1.00
R1451:Robo3 UTSW 9 37417711 missense probably benign 0.01
R1575:Robo3 UTSW 9 37429661 missense probably damaging 1.00
R1596:Robo3 UTSW 9 37424632 critical splice donor site probably null
R1660:Robo3 UTSW 9 37429144 missense probably damaging 1.00
R1677:Robo3 UTSW 9 37417709 missense possibly damaging 0.75
R1839:Robo3 UTSW 9 37422327 missense probably benign 0.00
R1878:Robo3 UTSW 9 37422165 missense probably damaging 1.00
R1891:Robo3 UTSW 9 37428055 missense probably damaging 1.00
R2040:Robo3 UTSW 9 37427464 missense probably damaging 1.00
R2859:Robo3 UTSW 9 37428104 nonsense probably null
R3786:Robo3 UTSW 9 37422225 missense probably damaging 1.00
R3888:Robo3 UTSW 9 37422181 nonsense probably null
R3910:Robo3 UTSW 9 37419295 missense probably damaging 1.00
R4212:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4213:Robo3 UTSW 9 37421898 missense probably damaging 1.00
R4691:Robo3 UTSW 9 37425218 missense probably damaging 0.99
R4979:Robo3 UTSW 9 37423344 missense probably damaging 1.00
R5238:Robo3 UTSW 9 37416879 missense probably damaging 0.99
R5570:Robo3 UTSW 9 37425275 missense possibly damaging 0.81
R5629:Robo3 UTSW 9 37419211 nonsense probably null
R5770:Robo3 UTSW 9 37419201 missense possibly damaging 0.87
R5837:Robo3 UTSW 9 37429816 critical splice acceptor site probably null
R6021:Robo3 UTSW 9 37422533 nonsense probably null
R6129:Robo3 UTSW 9 37423293 missense probably benign
R6232:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6233:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6235:Robo3 UTSW 9 37420929 missense probably damaging 1.00
R6326:Robo3 UTSW 9 37427027 missense probably damaging 1.00
R6354:Robo3 UTSW 9 37417217 unclassified probably benign
R6355:Robo3 UTSW 9 37418939 missense possibly damaging 0.71
R6475:Robo3 UTSW 9 37423290 missense probably damaging 0.99
R6937:Robo3 UTSW 9 37429880 missense probably benign 0.16
R7201:Robo3 UTSW 9 37424330 nonsense probably null
R7208:Robo3 UTSW 9 37424724 missense probably damaging 0.99
R7249:Robo3 UTSW 9 37424833 missense probably benign
R7376:Robo3 UTSW 9 37432916 missense probably damaging 1.00
R7380:Robo3 UTSW 9 37418556 missense probably damaging 1.00
R7448:Robo3 UTSW 9 37424815 missense possibly damaging 0.89
R7475:Robo3 UTSW 9 37425378 missense probably benign 0.01
R7496:Robo3 UTSW 9 37427825 missense probably damaging 1.00
R7587:Robo3 UTSW 9 37429646 missense probably damaging 1.00
R7694:Robo3 UTSW 9 37418520 missense probably benign 0.14
R8381:Robo3 UTSW 9 37429760 missense probably damaging 1.00
R8464:Robo3 UTSW 9 37421430 missense probably damaging 1.00
R8495:Robo3 UTSW 9 37425368 missense probably damaging 1.00
R8886:Robo3 UTSW 9 37417472 missense probably damaging 0.99
R9422:Robo3 UTSW 9 37418493 missense probably benign 0.03
R9563:Robo3 UTSW 9 37429604 missense probably damaging 1.00
R9564:Robo3 UTSW 9 37429604 missense probably damaging 1.00
R9681:Robo3 UTSW 9 37423262 missense possibly damaging 0.75
R9681:Robo3 UTSW 9 37427791 missense probably benign 0.45
X0024:Robo3 UTSW 9 37427855 missense probably damaging 1.00
X0027:Robo3 UTSW 9 37427825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGGCCTCAAGTTTCATCC -3'
(R):5'- CGGTTAGAAATGGCATGGCG -3'

Sequencing Primer
(F):5'- TCCTCCCAGTTCTTACATGACAGAAC -3'
(R):5'- CCATGAGGGCATCTGAGGAGTG -3'
Posted On 2015-04-17