Incidental Mutation 'R3886:Slc35f2'
ID309656
Institutional Source Beutler Lab
Gene Symbol Slc35f2
Ensembl Gene ENSMUSG00000042195
Gene Namesolute carrier family 35, member F2
Synonyms
MMRRC Submission 040798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3886 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53771538-53818154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53816957 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 372 (S372T)
Ref Sequence ENSEMBL: ENSMUSP00000046528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048670]
Predicted Effect probably benign
Transcript: ENSMUST00000048670
AA Change: S372T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046528
Gene: ENSMUSG00000042195
AA Change: S372T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SLC35F 35 334 7.2e-148 PFAM
Pfam:CRT-like 47 255 4.5e-14 PFAM
Pfam:EamA 196 334 2.1e-10 PFAM
low complexity region 339 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,213 N331S probably benign Het
2410089E03Rik T A 15: 8,171,805 V22E probably damaging Het
4933407L21Rik T A 1: 85,940,551 probably null Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B020004J07Rik T C 4: 101,835,723 K360R probably benign Het
Ccdc73 A T 2: 104,991,343 T546S possibly damaging Het
Cd22 T C 7: 30,870,107 D354G possibly damaging Het
Chchd6 T C 6: 89,467,451 E183G probably damaging Het
Col6a5 A G 9: 105,930,930 L973P unknown Het
Cp T C 3: 19,989,111 L1021P probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
D630045J12Rik A G 6: 38,142,698 V1703A possibly damaging Het
Dennd1a T C 2: 37,858,077 N376S possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Ect2l C T 10: 18,168,458 V310M probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gm8674 T C 13: 49,902,163 noncoding transcript Het
Ice1 T C 13: 70,605,370 T866A probably benign Het
Jade2 C T 11: 51,830,499 V201I possibly damaging Het
Kcnb2 T C 1: 15,710,415 S504P probably damaging Het
Kcng4 T C 8: 119,633,247 K130R probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrrk1 C T 7: 66,292,364 V709I probably damaging Het
Mdh1 A G 11: 21,559,832 V181A probably damaging Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr978 A G 9: 39,994,539 H243R probably damaging Het
Papd5 C A 8: 88,200,415 A151E probably benign Het
Ppp1r3a A C 6: 14,719,912 D334E possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G A 13: 37,898,506 probably null Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Tnxb A G 17: 34,718,911 D3896G probably damaging Het
Tti1 A G 2: 158,008,950 V123A possibly damaging Het
Usp1 T C 4: 98,929,736 C147R probably damaging Het
Vill A G 9: 119,066,714 N106S probably benign Het
Other mutations in Slc35f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slc35f2 APN 9 53798014 critical splice donor site probably null
IGL01476:Slc35f2 APN 9 53806706 missense possibly damaging 0.88
IGL01732:Slc35f2 APN 9 53806625 missense probably damaging 1.00
IGL02719:Slc35f2 APN 9 53809742 splice site probably benign
R0449:Slc35f2 UTSW 9 53816917 missense probably damaging 1.00
R1268:Slc35f2 UTSW 9 53797913 nonsense probably null
R1539:Slc35f2 UTSW 9 53809708 missense possibly damaging 0.66
R4748:Slc35f2 UTSW 9 53771785 start codon destroyed probably benign 0.23
R4779:Slc35f2 UTSW 9 53809729 missense possibly damaging 0.80
R5438:Slc35f2 UTSW 9 53801018 missense probably benign
R7308:Slc35f2 UTSW 9 53798010 missense probably benign 0.00
R7520:Slc35f2 UTSW 9 53801101 missense possibly damaging 0.57
R7680:Slc35f2 UTSW 9 53808112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGTATGAGGGAGTGCAAC -3'
(R):5'- TTTCTAGTTTGGAACCACTGGTC -3'

Sequencing Primer
(F):5'- GGAGTGCAACTAACTGCCTG -3'
(R):5'- GGTCAGTGCTCCTTTCTACAATC -3'
Posted On2015-04-17