Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Vill'

309658

Institutional Source

Beutler Lab

Gene Symbol

Vill

Ensembl Gene

ENSMUSG00000038775

Gene Name

villin-like

Synonyms

Villp

MMRRC Submission

040798-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119052778-119071525 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119066714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 106 (N106S)

Ref Sequence

ENSEMBL: ENSMUSP00000123393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000136561] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000010804

SMART Domains

Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660

Domain	Start	End	E-Value	Type
PH	22	132	9.41e-10	SMART
EFh	144	172	2.87e-2	SMART
EFh	180	208	9.34e1	SMART
Pfam:EF-hand_like	213	295	1.2e-23	PFAM
PLCXc	296	440	5.47e-94	SMART
low complexity region	461	472	N/A	INTRINSIC
PLCYc	492	609	1.22e-68	SMART
C2	630	735	1.78e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000051386
AA Change: N498S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: N498S

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000074734
AA Change: N498S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: N498S

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126251
AA Change: N53S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775
AA Change: N53S

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136561
AA Change: N106S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775
AA Change: N106S

Domain	Start	End	E-Value	Type
GEL	1	96	2.46e-13	SMART
Blast:GEL	116	140	2e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000141185
AA Change: N114S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775
AA Change: N114S

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153630

Predicted Effect

probably benign
Transcript: ENSMUST00000213464

Predicted Effect

probably benign
Transcript: ENSMUST00000214470

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Cd22	T	C	7: 30,870,107	D354G	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dennd1a	T	C	2: 37,858,077	N376S	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcnb2	T	C	1: 15,710,415	S504P	probably damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrrk1	C	T	7: 66,292,364	V709I	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ppp1r3a	A	C	6: 14,719,912	D334E	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Tti1	A	G	2: 158,008,950	V123A	possibly damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het

Other mutations in Vill

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Vill	APN	9	119063312	missense	probably damaging	1.00
IGL01024:Vill	APN	9	119070350	critical splice donor site	probably null
IGL01934:Vill	APN	9	119066809	missense	probably damaging	1.00
IGL02118:Vill	APN	9	119060398	missense	probably benign	0.44
IGL02260:Vill	APN	9	119058441	missense	probably benign	0.00
IGL02507:Vill	APN	9	119070777	missense	possibly damaging	0.86
IGL02870:Vill	APN	9	119061899	missense	probably damaging	1.00
IGL02941:Vill	APN	9	119066887	unclassified	probably benign
IGL02835:Vill	UTSW	9	119067445	missense	probably benign	0.11
R0285:Vill	UTSW	9	119070827	unclassified	probably benign
R0571:Vill	UTSW	9	119070633	missense	possibly damaging	0.93
R1024:Vill	UTSW	9	119066824	missense	probably damaging	1.00
R1168:Vill	UTSW	9	119070321	missense	probably damaging	0.99
R1374:Vill	UTSW	9	119061494	missense	probably benign	0.03
R1400:Vill	UTSW	9	119063347	missense	probably benign	0.01
R1551:Vill	UTSW	9	119063372	missense	probably benign
R1584:Vill	UTSW	9	119065586	missense	probably damaging	1.00
R1630:Vill	UTSW	9	119070701	missense	probably benign	0.37
R1721:Vill	UTSW	9	119066014	missense	probably damaging	0.98
R1946:Vill	UTSW	9	119058492	missense	probably benign
R2311:Vill	UTSW	9	119065897	missense	probably benign	0.08
R2392:Vill	UTSW	9	119067560	unclassified	probably benign
R2509:Vill	UTSW	9	119070302	missense	possibly damaging	0.84
R2760:Vill	UTSW	9	119066882	critical splice donor site	probably null
R3944:Vill	UTSW	9	119068431	missense	probably benign	0.10
R4245:Vill	UTSW	9	119071291	unclassified	probably benign
R4246:Vill	UTSW	9	119060393	missense	probably damaging	1.00
R4771:Vill	UTSW	9	119068434	missense	probably damaging	1.00
R4889:Vill	UTSW	9	119063341	missense	possibly damaging	0.50
R4932:Vill	UTSW	9	119061511	missense	probably damaging	1.00
R4946:Vill	UTSW	9	119068440	missense	probably damaging	1.00
R5121:Vill	UTSW	9	119070025	missense	possibly damaging	0.92
R5646:Vill	UTSW	9	119071162	missense	probably damaging	1.00
R6089:Vill	UTSW	9	119057799	missense	probably benign	0.00
R6149:Vill	UTSW	9	119058414	missense	possibly damaging	0.67
R6167:Vill	UTSW	9	119066864	missense	probably damaging	0.98
R6318:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6319:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6590:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6690:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6889:Vill	UTSW	9	119065882	missense	possibly damaging	0.58
R7207:Vill	UTSW	9	119071213	missense	possibly damaging	0.64
R7353:Vill	UTSW	9	119065493	missense	probably damaging	0.99
R7398:Vill	UTSW	9	119070648	missense	probably benign	0.26
R7883:Vill	UTSW	9	119065521	nonsense	probably null
R8165:Vill	UTSW	9	119066753	missense	probably damaging	0.98
R8281:Vill	UTSW	9	119058479	missense	probably damaging	1.00
R8380:Vill	UTSW	9	119057849	missense	probably benign	0.04
R8685:Vill	UTSW	9	119066727	missense	probably benign	0.00
R8847:Vill	UTSW	9	119068446	missense	probably damaging	0.99
R8968:Vill	UTSW	9	119063603	critical splice donor site	probably null
R9290:Vill	UTSW	9	119061494	missense	probably benign	0.03
RF005:Vill	UTSW	9	119060439	missense	probably damaging	1.00
Z1176:Vill	UTSW	9	119069965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTGTATATCATGGTGGC -3'
(R):5'- CTGGTACCTTCCCAAACCAG -3'

Sequencing Primer
(F):5'- CTGTATATCATGGTGGCAGAACC -3'
(R):5'- CCAGAGATAGCAAACATGACTTGTG -3'

Posted On

2015-04-17