Incidental Mutation 'R3886:Vill'
ID 309658
Institutional Source Beutler Lab
Gene Symbol Vill
Ensembl Gene ENSMUSG00000038775
Gene Name villin-like
Synonyms Villp
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 118881846-118900593 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118895782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 106 (N106S)
Ref Sequence ENSEMBL: ENSMUSP00000123393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000136561] [ENSMUST00000141185] [ENSMUST00000214470] [ENSMUST00000213464]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000010804
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051386
AA Change: N498S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: N498S

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
AA Change: N498S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: N498S

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
AA Change: N53S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775
AA Change: N53S

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136561
AA Change: N106S

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775
AA Change: N106S

DomainStartEndE-ValueType
GEL 1 96 2.46e-13 SMART
Blast:GEL 116 140 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141185
AA Change: N114S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775
AA Change: N114S

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Predicted Effect probably benign
Transcript: ENSMUST00000214470
Predicted Effect probably benign
Transcript: ENSMUST00000213464
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ccdc73 A T 2: 104,821,688 (GRCm39) T546S possibly damaging Het
Cd22 T C 7: 30,569,532 (GRCm39) D354G possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gm8674 T C 13: 50,056,199 (GRCm39) noncoding transcript Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcnb2 T C 1: 15,780,639 (GRCm39) S504P probably damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrrk1 C T 7: 65,942,112 (GRCm39) V709I probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Other mutations in Vill
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Vill APN 9 118,892,380 (GRCm39) missense probably damaging 1.00
IGL01024:Vill APN 9 118,899,418 (GRCm39) critical splice donor site probably null
IGL01934:Vill APN 9 118,895,877 (GRCm39) missense probably damaging 1.00
IGL02118:Vill APN 9 118,889,466 (GRCm39) missense probably benign 0.44
IGL02260:Vill APN 9 118,887,509 (GRCm39) missense probably benign 0.00
IGL02507:Vill APN 9 118,899,845 (GRCm39) missense possibly damaging 0.86
IGL02870:Vill APN 9 118,890,967 (GRCm39) missense probably damaging 1.00
IGL02941:Vill APN 9 118,895,955 (GRCm39) unclassified probably benign
IGL02835:Vill UTSW 9 118,896,513 (GRCm39) missense probably benign 0.11
R0285:Vill UTSW 9 118,899,895 (GRCm39) unclassified probably benign
R0571:Vill UTSW 9 118,899,701 (GRCm39) missense possibly damaging 0.93
R1024:Vill UTSW 9 118,895,892 (GRCm39) missense probably damaging 1.00
R1168:Vill UTSW 9 118,899,389 (GRCm39) missense probably damaging 0.99
R1374:Vill UTSW 9 118,890,562 (GRCm39) missense probably benign 0.03
R1400:Vill UTSW 9 118,892,415 (GRCm39) missense probably benign 0.01
R1551:Vill UTSW 9 118,892,440 (GRCm39) missense probably benign
R1584:Vill UTSW 9 118,894,654 (GRCm39) missense probably damaging 1.00
R1630:Vill UTSW 9 118,899,769 (GRCm39) missense probably benign 0.37
R1721:Vill UTSW 9 118,895,082 (GRCm39) missense probably damaging 0.98
R1946:Vill UTSW 9 118,887,560 (GRCm39) missense probably benign
R2311:Vill UTSW 9 118,894,965 (GRCm39) missense probably benign 0.08
R2392:Vill UTSW 9 118,896,628 (GRCm39) unclassified probably benign
R2509:Vill UTSW 9 118,899,370 (GRCm39) missense possibly damaging 0.84
R2760:Vill UTSW 9 118,895,950 (GRCm39) critical splice donor site probably null
R3944:Vill UTSW 9 118,897,499 (GRCm39) missense probably benign 0.10
R4245:Vill UTSW 9 118,900,359 (GRCm39) unclassified probably benign
R4246:Vill UTSW 9 118,889,461 (GRCm39) missense probably damaging 1.00
R4771:Vill UTSW 9 118,897,502 (GRCm39) missense probably damaging 1.00
R4889:Vill UTSW 9 118,892,409 (GRCm39) missense possibly damaging 0.50
R4932:Vill UTSW 9 118,890,579 (GRCm39) missense probably damaging 1.00
R4946:Vill UTSW 9 118,897,508 (GRCm39) missense probably damaging 1.00
R5121:Vill UTSW 9 118,899,093 (GRCm39) missense possibly damaging 0.92
R5646:Vill UTSW 9 118,900,230 (GRCm39) missense probably damaging 1.00
R6089:Vill UTSW 9 118,886,867 (GRCm39) missense probably benign 0.00
R6149:Vill UTSW 9 118,887,482 (GRCm39) missense possibly damaging 0.67
R6167:Vill UTSW 9 118,895,932 (GRCm39) missense probably damaging 0.98
R6318:Vill UTSW 9 118,892,716 (GRCm39) missense probably benign 0.15
R6319:Vill UTSW 9 118,892,716 (GRCm39) missense probably benign 0.15
R6590:Vill UTSW 9 118,890,975 (GRCm39) missense probably benign 0.04
R6690:Vill UTSW 9 118,890,975 (GRCm39) missense probably benign 0.04
R6889:Vill UTSW 9 118,894,950 (GRCm39) missense possibly damaging 0.58
R7207:Vill UTSW 9 118,900,281 (GRCm39) missense possibly damaging 0.64
R7353:Vill UTSW 9 118,894,561 (GRCm39) missense probably damaging 0.99
R7398:Vill UTSW 9 118,899,716 (GRCm39) missense probably benign 0.26
R7883:Vill UTSW 9 118,894,589 (GRCm39) nonsense probably null
R8165:Vill UTSW 9 118,895,821 (GRCm39) missense probably damaging 0.98
R8281:Vill UTSW 9 118,887,547 (GRCm39) missense probably damaging 1.00
R8380:Vill UTSW 9 118,886,917 (GRCm39) missense probably benign 0.04
R8685:Vill UTSW 9 118,895,795 (GRCm39) missense probably benign 0.00
R8847:Vill UTSW 9 118,897,514 (GRCm39) missense probably damaging 0.99
R8968:Vill UTSW 9 118,892,671 (GRCm39) critical splice donor site probably null
R9290:Vill UTSW 9 118,890,562 (GRCm39) missense probably benign 0.03
RF005:Vill UTSW 9 118,889,507 (GRCm39) missense probably damaging 1.00
Z1176:Vill UTSW 9 118,899,033 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTATATCATGGTGGC -3'
(R):5'- CTGGTACCTTCCCAAACCAG -3'

Sequencing Primer
(F):5'- CTGTATATCATGGTGGCAGAACC -3'
(R):5'- CCAGAGATAGCAAACATGACTTGTG -3'
Posted On 2015-04-17