Incidental Mutation 'R0381:Sypl2'
ID30966
Institutional Source Beutler Lab
Gene Symbol Sypl2
Ensembl Gene ENSMUSG00000027887
Gene Namesynaptophysin-like 2
SynonymsMg29
MMRRC Submission 038587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0381 (G1)
Quality Score198
Status Not validated
Chromosome3
Chromosomal Location108211472-108226648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108226157 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 32 (E32G)
Ref Sequence ENSEMBL: ENSMUSP00000116756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141387]
Predicted Effect possibly damaging
Transcript: ENSMUST00000141387
AA Change: E32G

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116756
Gene: ENSMUSG00000027887
AA Change: E32G

DomainStartEndE-ValueType
low complexity region 9 65 N/A INTRINSIC
Pfam:MARVEL 107 309 7.2e-41 PFAM
low complexity region 318 326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198175
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile, but exhibit reduced body weight, abnormal skeletal muscle membranes and irregular skeletal muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,108,434 V1297A possibly damaging Het
Agbl2 C T 2: 90,784,098 H25Y probably damaging Het
Akap11 A T 14: 78,513,550 W466R probably benign Het
BC048403 T C 10: 121,745,375 Y94H probably damaging Het
Ccdc66 T A 14: 27,491,933 Q471L probably damaging Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
F13b A G 1: 139,510,859 K334E probably damaging Het
Fam186a A C 15: 99,942,174 I2063R probably damaging Het
Fcrl5 T C 3: 87,446,460 Y371H probably damaging Het
Fnbp1 C T 2: 31,033,029 G549D probably benign Het
Fndc3a A G 14: 72,556,627 Y869H probably benign Het
Gm7592 A G 1: 85,526,716 noncoding transcript Het
Gucy2d C A 7: 98,459,002 probably null Het
Hmcn1 C T 1: 150,603,811 C4634Y probably damaging Het
Kctd5 A G 17: 24,059,220 probably null Het
Mettl24 C A 10: 40,746,390 H203N probably damaging Het
Mitf A G 6: 97,993,143 E17G probably damaging Het
Mrc1 G A 2: 14,307,909 D881N probably benign Het
Mrm1 T C 11: 84,818,683 T183A possibly damaging Het
Mut T A 17: 40,937,258 W59R probably benign Het
Mylk G A 16: 34,784,974 probably null Het
Nab2 G A 10: 127,665,067 A19V probably damaging Het
Ntsr2 T A 12: 16,659,718 Y333* probably null Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Tasp1 T C 2: 139,951,483 K258E probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm4 G T 7: 96,905,881 V2561F probably damaging Het
Tmc1 T C 19: 20,799,045 Y650C probably damaging Het
Trim34b T C 7: 104,329,855 L103P probably damaging Het
Usp47 T C 7: 112,063,393 probably null Het
Vmn1r201 T A 13: 22,475,023 W136R probably damaging Het
Vmn2r104 A T 17: 20,048,002 Y68* probably null Het
Wscd2 T A 5: 113,551,131 L66Q probably damaging Het
Other mutations in Sypl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Sypl2 APN 3 108226426 start gained probably benign
R0147:Sypl2 UTSW 3 108219095 missense possibly damaging 0.91
R0148:Sypl2 UTSW 3 108219095 missense possibly damaging 0.91
R0512:Sypl2 UTSW 3 108226170 missense possibly damaging 0.51
R0751:Sypl2 UTSW 3 108216756 missense probably damaging 0.98
R1279:Sypl2 UTSW 3 108217674 missense probably damaging 1.00
R3411:Sypl2 UTSW 3 108216729 missense possibly damaging 0.94
R4085:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4086:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4088:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4089:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4090:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R7063:Sypl2 UTSW 3 108217655 missense probably benign 0.31
R7571:Sypl2 UTSW 3 108214538 makesense probably null
R7980:Sypl2 UTSW 3 108217692 missense probably damaging 1.00
R8364:Sypl2 UTSW 3 108217734 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTCTCGTCCGAGTGAAATGTGAGC -3'
(R):5'- GTCCCGAATGTGTCTGATTCCGTC -3'

Sequencing Primer
(F):5'- TTGCACATAGAAGGTCCGAATC -3'
(R):5'- AATGTGTCTGATTCCGTCTCTCC -3'
Posted On2013-04-24