Incidental Mutation 'R3886:Mdh1'
ID309661
Institutional Source Beutler Lab
Gene Symbol Mdh1
Ensembl Gene ENSMUSG00000020321
Gene Namemalate dehydrogenase 1, NAD (soluble)
SynonymsMor2, MDH-s, Mor-2, B230377B03Rik
MMRRC Submission 040798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3886 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21556787-21572367 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21559832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 181 (V181A)
Ref Sequence ENSEMBL: ENSMUSP00000099938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102874] [ENSMUST00000125302]
Predicted Effect probably damaging
Transcript: ENSMUST00000102874
AA Change: V181A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099938
Gene: ENSMUSG00000020321
AA Change: V181A

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 7.3e-41 PFAM
Pfam:Ldh_1_C 156 331 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125302
SMART Domains Protein: ENSMUSP00000119816
Gene: ENSMUSG00000020321

DomainStartEndE-ValueType
Pfam:Ldh_1_N 5 153 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175427
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. A pseudogene has been identified on chromosomes 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: An ENU-induced mutation results in prenatal lethality in homozygotes and decreased enzyme activity in heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,213 N331S probably benign Het
2410089E03Rik T A 15: 8,171,805 V22E probably damaging Het
4933407L21Rik T A 1: 85,940,551 probably null Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B020004J07Rik T C 4: 101,835,723 K360R probably benign Het
Ccdc73 A T 2: 104,991,343 T546S possibly damaging Het
Cd22 T C 7: 30,870,107 D354G possibly damaging Het
Chchd6 T C 6: 89,467,451 E183G probably damaging Het
Col6a5 A G 9: 105,930,930 L973P unknown Het
Cp T C 3: 19,989,111 L1021P probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
D630045J12Rik A G 6: 38,142,698 V1703A possibly damaging Het
Dennd1a T C 2: 37,858,077 N376S possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Ect2l C T 10: 18,168,458 V310M probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gm8674 T C 13: 49,902,163 noncoding transcript Het
Ice1 T C 13: 70,605,370 T866A probably benign Het
Jade2 C T 11: 51,830,499 V201I possibly damaging Het
Kcnb2 T C 1: 15,710,415 S504P probably damaging Het
Kcng4 T C 8: 119,633,247 K130R probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrrk1 C T 7: 66,292,364 V709I probably damaging Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr978 A G 9: 39,994,539 H243R probably damaging Het
Papd5 C A 8: 88,200,415 A151E probably benign Het
Ppp1r3a A C 6: 14,719,912 D334E possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G A 13: 37,898,506 probably null Het
Slc35f2 T A 9: 53,816,957 S372T probably benign Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Tnxb A G 17: 34,718,911 D3896G probably damaging Het
Tti1 A G 2: 158,008,950 V123A possibly damaging Het
Usp1 T C 4: 98,929,736 C147R probably damaging Het
Vill A G 9: 119,066,714 N106S probably benign Het
Other mutations in Mdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Mdh1 APN 11 21557438 utr 3 prime probably benign
IGL02273:Mdh1 APN 11 21559786 missense probably benign 0.38
IGL03198:Mdh1 APN 11 21564168 missense probably damaging 1.00
PIT4480001:Mdh1 UTSW 11 21558538 missense probably damaging 1.00
R0771:Mdh1 UTSW 11 21557550 missense probably benign 0.27
R1016:Mdh1 UTSW 11 21559769 missense probably benign 0.01
R3854:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R3855:Mdh1 UTSW 11 21559281 missense probably benign 0.31
R4474:Mdh1 UTSW 11 21566624 missense possibly damaging 0.49
R4507:Mdh1 UTSW 11 21558470 missense probably benign 0.01
R4724:Mdh1 UTSW 11 21562957 missense probably damaging 1.00
R4986:Mdh1 UTSW 11 21558545 missense possibly damaging 0.85
R5472:Mdh1 UTSW 11 21559786 missense probably benign 0.38
R7088:Mdh1 UTSW 11 21558484 missense probably damaging 1.00
X0063:Mdh1 UTSW 11 21562870 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACACTCAGCTCAGCAGTGTG -3'
(R):5'- TTAGGATCTTGCTGAGCAGTAAC -3'

Sequencing Primer
(F):5'- CAGTGTGCTGTGTGTCTCCTC -3'
(R):5'- GCTGAGCAGTAACATTTGCC -3'
Posted On2015-04-17