Mutagenetix > Incidental Mutation

Incidental Mutation 'R3886:Adam17'

309663

Institutional Source

Beutler Lab

Gene Symbol

Adam17

Ensembl Gene

ENSMUSG00000052593

Gene Name

a disintegrin and metallopeptidase domain 17

Synonyms

CD156b, Tace

MMRRC Submission

040798-MU

Accession Numbers

Genbank: NM_009615; MGI: 1096335

Essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R3886 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21323509-21373632 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21325587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 744 (R744C)

Ref Sequence

ENSEMBL: ENSMUSP00000099087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000076813] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000145118] [ENSMUST00000221693] [ENSMUST00000223345] [ENSMUST00000232107] [ENSMUST00000232526]

AlphaFold

Q9Z0F8

Predicted Effect

probably damaging
Transcript: ENSMUST00000064536
AA Change: R725C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: R725C

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	28	167	1.1e-11	PFAM
Pfam:Reprolysin_5	221	451	6.7e-37	PFAM
Pfam:Reprolysin_4	221	469	3.2e-24	PFAM
Pfam:Reprolysin_2	244	464	8.8e-29	PFAM
Pfam:Reprolysin_3	248	416	1.2e-12	PFAM
Pfam:Reprolysin	383	474	3.1e-9	PFAM
DISIN	484	561	6.27e-26	SMART
PDB:2M2F\|A	581	642	4e-32	PDB
transmembrane domain	672	694	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000076813

SMART Domains

Protein: ENSMUSP00000076090
Gene: ENSMUSG00000062054

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL	18	213	1.3e-34	PFAM
Pfam:Lipase_GDSL_2	19	209	2.8e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000101551
AA Change: R744C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: R744C

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	31	167	9.7e-15	PFAM
Pfam:Reprolysin_5	221	470	5e-34	PFAM
Pfam:Reprolysin_4	221	488	6.1e-20	PFAM
Pfam:Reprolysin_2	264	483	2.6e-34	PFAM
Pfam:Reprolysin_3	267	435	2.8e-14	PFAM
Pfam:Reprolysin	330	493	5.3e-9	PFAM
DISIN	503	580	6.27e-26	SMART
Pfam:ADAM17_MPD	600	661	1e-23	PFAM
transmembrane domain	691	713	N/A	INTRINSIC
low complexity region	758	774	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127974

SMART Domains

Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	25	167	9.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141799

Predicted Effect

probably benign
Transcript: ENSMUST00000145118

SMART Domains

Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Pep_M12B_propep	28	167	7.5e-12	PFAM
Pfam:Reprolysin_5	221	451	4.2e-37	PFAM
Pfam:Reprolysin_4	221	469	2e-24	PFAM
Pfam:Reprolysin_2	244	464	5.6e-29	PFAM
Pfam:Reprolysin_3	248	416	7.8e-13	PFAM
Pfam:Reprolysin	381	474	2.2e-9	PFAM
DISIN	484	561	6.27e-26	SMART
PDB:2M2F\|A	581	638	5e-29	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155115

Predicted Effect

probably benign
Transcript: ENSMUST00000221693

Predicted Effect

probably benign
Transcript: ENSMUST00000222344

Predicted Effect

probably benign
Transcript: ENSMUST00000223345

Predicted Effect

probably benign
Transcript: ENSMUST00000232107

Predicted Effect

probably benign
Transcript: ENSMUST00000232526

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,692,213	N331S	probably benign	Het
2410089E03Rik	T	A	15: 8,171,805	V22E	probably damaging	Het
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
B020004J07Rik	T	C	4: 101,835,723	K360R	probably benign	Het
Ccdc73	A	T	2: 104,991,343	T546S	possibly damaging	Het
Cd22	T	C	7: 30,870,107	D354G	possibly damaging	Het
Chchd6	T	C	6: 89,467,451	E183G	probably damaging	Het
Col6a5	A	G	9: 105,930,930	L973P	unknown	Het
Cp	T	C	3: 19,989,111	L1021P	probably damaging	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
D630045J12Rik	A	G	6: 38,142,698	V1703A	possibly damaging	Het
Dennd1a	T	C	2: 37,858,077	N376S	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Ect2l	C	T	10: 18,168,458	V310M	probably damaging	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gm8674	T	C	13: 49,902,163		noncoding transcript	Het
Ice1	T	C	13: 70,605,370	T866A	probably benign	Het
Jade2	C	T	11: 51,830,499	V201I	possibly damaging	Het
Kcnb2	T	C	1: 15,710,415	S504P	probably damaging	Het
Kcng4	T	C	8: 119,633,247	K130R	probably benign	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrrk1	C	T	7: 66,292,364	V709I	probably damaging	Het
Mdh1	A	G	11: 21,559,832	V181A	probably damaging	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr978	A	G	9: 39,994,539	H243R	probably damaging	Het
Papd5	C	A	8: 88,200,415	A151E	probably benign	Het
Ppp1r3a	A	C	6: 14,719,912	D334E	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	A	13: 37,898,506		probably null	Het
Slc35f2	T	A	9: 53,816,957	S372T	probably benign	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Tnxb	A	G	17: 34,718,911	D3896G	probably damaging	Het
Tti1	A	G	2: 158,008,950	V123A	possibly damaging	Het
Usp1	T	C	4: 98,929,736	C147R	probably damaging	Het
Vill	A	G	9: 119,066,714	N106S	probably benign	Het

Other mutations in Adam17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00555:Adam17	APN	12	21328109	missense	probably damaging	1.00
IGL01340:Adam17	APN	12	21330057	nonsense	probably null
IGL01973:Adam17	APN	12	21349943	missense	probably damaging	1.00
IGL02223:Adam17	APN	12	21361705	missense	possibly damaging	0.92
IGL03153:Adam17	APN	12	21345697	missense	probably damaging	1.00
Steinway	UTSW	12	21353948	missense	probably damaging	1.00
wavedx	UTSW	12	21340750	missense	probably damaging	1.00
R0014:Adam17	UTSW	12	21336644	missense	probably benign	0.36
R0080:Adam17	UTSW	12	21329048	splice site	probably benign
R0082:Adam17	UTSW	12	21329048	splice site	probably benign
R0324:Adam17	UTSW	12	21349938	missense	probably benign	0.00
R0511:Adam17	UTSW	12	21340458	splice site	probably benign
R0745:Adam17	UTSW	12	21332221	splice site	probably benign
R1314:Adam17	UTSW	12	21329071	missense	probably damaging	1.00
R1547:Adam17	UTSW	12	21353957	missense	probably damaging	1.00
R1594:Adam17	UTSW	12	21340470	critical splice donor site	probably null
R1607:Adam17	UTSW	12	21334138	splice site	probably null
R1812:Adam17	UTSW	12	21361767	missense	probably damaging	0.97
R2020:Adam17	UTSW	12	21349875	missense	probably damaging	1.00
R3408:Adam17	UTSW	12	21329118	missense	probably damaging	1.00
R3735:Adam17	UTSW	12	21325412	missense	probably benign	0.05
R3888:Adam17	UTSW	12	21325587	missense	probably damaging	1.00
R4062:Adam17	UTSW	12	21325457	missense	probably damaging	1.00
R4415:Adam17	UTSW	12	21345701	missense	possibly damaging	0.90
R4563:Adam17	UTSW	12	21332088	missense	probably damaging	1.00
R4658:Adam17	UTSW	12	21332160	missense	probably damaging	1.00
R4763:Adam17	UTSW	12	21334015	missense	probably benign
R4793:Adam17	UTSW	12	21347395	missense	probably benign
R5101:Adam17	UTSW	12	21373405	missense	possibly damaging	0.85
R5120:Adam17	UTSW	12	21343019	intron	probably benign
R5514:Adam17	UTSW	12	21340519	missense	probably damaging	0.98
R5592:Adam17	UTSW	12	21334137	missense	probably damaging	1.00
R5874:Adam17	UTSW	12	21329086	missense	possibly damaging	0.76
R6110:Adam17	UTSW	12	21353948	missense	probably damaging	1.00
R6451:Adam17	UTSW	12	21342882	missense	probably benign	0.00
R6930:Adam17	UTSW	12	21353948	missense	probably damaging	1.00
R6970:Adam17	UTSW	12	21345668	missense	probably benign	0.06
R7213:Adam17	UTSW	12	21336678	nonsense	probably null
R7302:Adam17	UTSW	12	21355693	intron	probably benign
R7361:Adam17	UTSW	12	21325601	missense	probably damaging	0.98
R7667:Adam17	UTSW	12	21333952	critical splice donor site	probably null
R7799:Adam17	UTSW	12	21340492	missense	probably damaging	1.00
R8762:Adam17	UTSW	12	21351594	missense	probably benign	0.03
R8958:Adam17	UTSW	12	21349933	missense	possibly damaging	0.61
R9108:Adam17	UTSW	12	21330131	missense	probably benign
R9163:Adam17	UTSW	12	21351587	missense	probably benign	0.00
R9295:Adam17	UTSW	12	21349937	missense	probably benign	0.02
R9345:Adam17	UTSW	12	21328055	missense	probably damaging	1.00
R9444:Adam17	UTSW	12	21325535	missense	probably benign	0.28
R9522:Adam17	UTSW	12	21345692	missense	probably damaging	1.00
R9582:Adam17	UTSW	12	21336664	missense	probably benign	0.14
X0063:Adam17	UTSW	12	21332585	missense	probably benign	0.17
Z1176:Adam17	UTSW	12	21361737	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTCAAAGGACTTGGCAGCTG -3'
(R):5'- CCATGGATCTTAATAGGCACAAGTTG -3'

Sequencing Primer
(F):5'- AAGGGGTCCTTCTCAAAACCGTC -3'
(R):5'- TAGGCACAAGTTGTCAGCATCTC -3'

Posted On

2015-04-17