Incidental Mutation 'R3886:Rreb1'
ID309664
Institutional Source Beutler Lab
Gene Symbol Rreb1
Ensembl Gene ENSMUSG00000039087
Gene Nameras responsive element binding protein 1
Synonyms1110037N09Rik, B930013M22Rik
MMRRC Submission 040798-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3886 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location37778400-37952005 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 37898506 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037232] [ENSMUST00000037232] [ENSMUST00000110237] [ENSMUST00000110238] [ENSMUST00000122842] [ENSMUST00000124373] [ENSMUST00000128570] [ENSMUST00000128570] [ENSMUST00000138043] [ENSMUST00000138110] [ENSMUST00000149745]
Predicted Effect probably null
Transcript: ENSMUST00000037232
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037232
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110237
SMART Domains Protein: ENSMUSP00000105866
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110238
SMART Domains Protein: ENSMUSP00000105867
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124268
Predicted Effect probably benign
Transcript: ENSMUST00000124373
Predicted Effect probably null
Transcript: ENSMUST00000128570
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128570
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138043
Predicted Effect probably benign
Transcript: ENSMUST00000138110
Predicted Effect probably null
Transcript: ENSMUST00000149745
SMART Domains Protein: ENSMUSP00000121211
Gene: ENSMUSG00000039087

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to RAS-responsive elements (RREs) of gene promoters. It has been shown that the calcitonin gene promoter contains an RRE and that the encoded protein binds there and increases expression of calcitonin, which may be involved in Ras/Raf-mediated cell differentiation. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,213 N331S probably benign Het
2410089E03Rik T A 15: 8,171,805 V22E probably damaging Het
4933407L21Rik T A 1: 85,940,551 probably null Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B020004J07Rik T C 4: 101,835,723 K360R probably benign Het
Ccdc73 A T 2: 104,991,343 T546S possibly damaging Het
Cd22 T C 7: 30,870,107 D354G possibly damaging Het
Chchd6 T C 6: 89,467,451 E183G probably damaging Het
Col6a5 A G 9: 105,930,930 L973P unknown Het
Cp T C 3: 19,989,111 L1021P probably damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
D630045J12Rik A G 6: 38,142,698 V1703A possibly damaging Het
Dennd1a T C 2: 37,858,077 N376S possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Ect2l C T 10: 18,168,458 V310M probably damaging Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gm8674 T C 13: 49,902,163 noncoding transcript Het
Ice1 T C 13: 70,605,370 T866A probably benign Het
Jade2 C T 11: 51,830,499 V201I possibly damaging Het
Kcnb2 T C 1: 15,710,415 S504P probably damaging Het
Kcng4 T C 8: 119,633,247 K130R probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrrk1 C T 7: 66,292,364 V709I probably damaging Het
Mdh1 A G 11: 21,559,832 V181A probably damaging Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr978 A G 9: 39,994,539 H243R probably damaging Het
Papd5 C A 8: 88,200,415 A151E probably benign Het
Ppp1r3a A C 6: 14,719,912 D334E possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Slc35f2 T A 9: 53,816,957 S372T probably benign Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Tnxb A G 17: 34,718,911 D3896G probably damaging Het
Tti1 A G 2: 158,008,950 V123A possibly damaging Het
Usp1 T C 4: 98,929,736 C147R probably damaging Het
Vill A G 9: 119,066,714 N106S probably benign Het
Other mutations in Rreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Rreb1 APN 13 37916496 missense probably benign 0.09
IGL00336:Rreb1 APN 13 37929646 nonsense probably null
IGL00473:Rreb1 APN 13 37930791 nonsense probably null
IGL01338:Rreb1 APN 13 37931034 missense probably damaging 1.00
IGL01836:Rreb1 APN 13 37931457 missense probably damaging 1.00
IGL02066:Rreb1 APN 13 37931506 missense probably benign 0.16
IGL02661:Rreb1 APN 13 37930802 nonsense probably null
IGL02739:Rreb1 APN 13 37893821 missense probably damaging 1.00
IGL03267:Rreb1 APN 13 37932193 missense probably benign 0.30
IGL03332:Rreb1 APN 13 37930916 missense probably benign 0.42
IGL03403:Rreb1 APN 13 37929574 missense possibly damaging 0.78
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0101:Rreb1 UTSW 13 37931542 missense probably benign 0.04
R0265:Rreb1 UTSW 13 37916155 nonsense probably null
R0635:Rreb1 UTSW 13 37941564 missense possibly damaging 0.92
R0939:Rreb1 UTSW 13 37932231 missense probably benign 0.09
R1099:Rreb1 UTSW 13 37948891 missense probably benign 0.16
R1438:Rreb1 UTSW 13 37930605 missense probably benign 0.16
R1457:Rreb1 UTSW 13 37946928 missense possibly damaging 0.52
R1510:Rreb1 UTSW 13 37931884 missense probably benign 0.04
R1672:Rreb1 UTSW 13 37930537 missense probably benign 0.09
R1772:Rreb1 UTSW 13 37930923 missense probably benign 0.09
R2171:Rreb1 UTSW 13 37930846 missense probably benign 0.00
R2371:Rreb1 UTSW 13 37916537 missense probably benign 0.09
R2566:Rreb1 UTSW 13 37929792 missense possibly damaging 0.62
R2571:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R2862:Rreb1 UTSW 13 37932453 missense probably benign 0.02
R2874:Rreb1 UTSW 13 37916508 missense probably benign 0.09
R2911:Rreb1 UTSW 13 37948920 missense probably benign 0.00
R3722:Rreb1 UTSW 13 37947098 missense probably benign 0.01
R3767:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3770:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3885:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3887:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3888:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3889:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R4064:Rreb1 UTSW 13 37930317 missense probably benign 0.42
R4134:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4135:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4174:Rreb1 UTSW 13 37930150 missense possibly damaging 0.95
R4250:Rreb1 UTSW 13 37893893 missense possibly damaging 0.63
R4287:Rreb1 UTSW 13 37931931 missense probably benign 0.03
R4396:Rreb1 UTSW 13 37930443 nonsense probably null
R4658:Rreb1 UTSW 13 37948801 missense probably damaging 1.00
R4841:Rreb1 UTSW 13 37916526 missense probably benign 0.09
R4856:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R4886:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R5092:Rreb1 UTSW 13 37928278 missense probably benign 0.09
R5122:Rreb1 UTSW 13 37930768 missense probably benign 0.02
R5405:Rreb1 UTSW 13 37949111 missense probably damaging 0.99
R5408:Rreb1 UTSW 13 37931344 missense probably benign 0.01
R5446:Rreb1 UTSW 13 37898497 missense possibly damaging 0.78
R5641:Rreb1 UTSW 13 37947421 missense probably benign 0.00
R5859:Rreb1 UTSW 13 37947408 missense probably benign 0.24
R5859:Rreb1 UTSW 13 37947409 missense probably benign 0.06
R6429:Rreb1 UTSW 13 37932129 missense probably benign 0.03
R6678:Rreb1 UTSW 13 37899699 missense probably damaging 1.00
R7130:Rreb1 UTSW 13 37899748 missense probably damaging 1.00
R7186:Rreb1 UTSW 13 37941632 missense probably benign 0.02
R7188:Rreb1 UTSW 13 37916568 missense possibly damaging 0.79
R7387:Rreb1 UTSW 13 37947064 missense unknown
R7453:Rreb1 UTSW 13 37941569 missense probably damaging 0.98
R7492:Rreb1 UTSW 13 37931748 missense probably benign 0.00
R7585:Rreb1 UTSW 13 37893898 missense probably benign 0.07
R7621:Rreb1 UTSW 13 37949066 missense
R7645:Rreb1 UTSW 13 37931034 missense probably damaging 1.00
R7653:Rreb1 UTSW 13 37930386 missense probably benign 0.19
R7670:Rreb1 UTSW 13 37931572 missense probably benign 0.00
R7701:Rreb1 UTSW 13 37930116 missense possibly damaging 0.60
R7708:Rreb1 UTSW 13 37929570 missense probably benign 0.18
R7874:Rreb1 UTSW 13 37947124 missense probably damaging 1.00
R8103:Rreb1 UTSW 13 37941701 missense probably benign 0.16
R8129:Rreb1 UTSW 13 37929799 missense probably benign 0.00
R8239:Rreb1 UTSW 13 37893872 missense probably damaging 1.00
R8324:Rreb1 UTSW 13 37947621 missense probably damaging 1.00
R8824:Rreb1 UTSW 13 37930516 missense probably damaging 0.99
X0024:Rreb1 UTSW 13 37931580 missense probably benign 0.09
X0026:Rreb1 UTSW 13 37931992 missense probably benign 0.17
Z1088:Rreb1 UTSW 13 37948937 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGGGCTTATGACAGAAGTGG -3'
(R):5'- CTCAGCGTCATCATGGTGTG -3'

Sequencing Primer
(F):5'- TGGAAGACACCAGTTCAGTG -3'
(R):5'- TATGTGTAAAGGCCCCCATG -3'
Posted On2015-04-17