Incidental Mutation 'R3886:Gm8674'
ID 309665
Institutional Source Beutler Lab
Gene Symbol Gm8674
Ensembl Gene ENSMUSG00000093976
Gene Name predicted gene 8674
Synonyms
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 50053085-50056359 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 50056199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179367
SMART Domains Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
Pfam:FAM75 92 444 3.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ccdc73 A T 2: 104,821,688 (GRCm39) T546S possibly damaging Het
Cd22 T C 7: 30,569,532 (GRCm39) D354G possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcnb2 T C 1: 15,780,639 (GRCm39) S504P probably damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrrk1 C T 7: 65,942,112 (GRCm39) V709I probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Vill A G 9: 118,895,782 (GRCm39) N106S probably benign Het
Other mutations in Gm8674
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Gm8674 UTSW 13 50,055,975 (GRCm39) exon noncoding transcript
R0357:Gm8674 UTSW 13 50,056,149 (GRCm39) exon noncoding transcript
R0627:Gm8674 UTSW 13 50,053,751 (GRCm39) exon noncoding transcript
R0833:Gm8674 UTSW 13 50,058,611 (GRCm39) exon noncoding transcript
R1300:Gm8674 UTSW 13 50,055,758 (GRCm39) exon noncoding transcript
R1452:Gm8674 UTSW 13 50,054,553 (GRCm39) exon noncoding transcript
R1542:Gm8674 UTSW 13 50,054,039 (GRCm39) exon noncoding transcript
R1613:Gm8674 UTSW 13 50,056,474 (GRCm39) intron noncoding transcript
R1643:Gm8674 UTSW 13 50,055,394 (GRCm39) exon noncoding transcript
R1732:Gm8674 UTSW 13 50,055,962 (GRCm39) exon noncoding transcript
R1824:Gm8674 UTSW 13 50,054,844 (GRCm39) exon noncoding transcript
R1840:Gm8674 UTSW 13 50,055,801 (GRCm39) exon noncoding transcript
R1915:Gm8674 UTSW 13 50,054,889 (GRCm39) exon noncoding transcript
R1934:Gm8674 UTSW 13 50,055,471 (GRCm39) exon noncoding transcript
R2040:Gm8674 UTSW 13 50,055,705 (GRCm39) exon noncoding transcript
R2214:Gm8674 UTSW 13 50,055,396 (GRCm39) exon noncoding transcript
R2421:Gm8674 UTSW 13 50,054,699 (GRCm39) exon noncoding transcript
R3423:Gm8674 UTSW 13 50,055,792 (GRCm39) exon noncoding transcript
R3425:Gm8674 UTSW 13 50,055,792 (GRCm39) exon noncoding transcript
R4083:Gm8674 UTSW 13 50,055,047 (GRCm39) exon noncoding transcript
R4343:Gm8674 UTSW 13 50,053,742 (GRCm39) exon noncoding transcript
R4570:Gm8674 UTSW 13 50,056,570 (GRCm39) intron noncoding transcript
R4936:Gm8674 UTSW 13 50,054,791 (GRCm39) exon noncoding transcript
R4967:Gm8674 UTSW 13 50,056,034 (GRCm39) exon noncoding transcript
R5065:Gm8674 UTSW 13 50,056,613 (GRCm39) intron noncoding transcript
R5067:Gm8674 UTSW 13 50,053,870 (GRCm39) exon noncoding transcript
R5120:Gm8674 UTSW 13 50,055,984 (GRCm39) exon noncoding transcript
R5208:Gm8674 UTSW 13 50,055,957 (GRCm39) exon noncoding transcript
R5268:Gm8674 UTSW 13 50,055,390 (GRCm39) exon noncoding transcript
R5471:Gm8674 UTSW 13 50,054,849 (GRCm39) exon noncoding transcript
R5773:Gm8674 UTSW 13 50,055,912 (GRCm39) exon noncoding transcript
R5809:Gm8674 UTSW 13 50,055,924 (GRCm39) exon noncoding transcript
R8162:Gm8674 UTSW 13 50,054,407 (GRCm39) missense noncoding transcript
R8239:Gm8674 UTSW 13 50,054,262 (GRCm39) missense noncoding transcript
Z1088:Gm8674 UTSW 13 50,055,284 (GRCm39) exon noncoding transcript
Z1088:Gm8674 UTSW 13 50,054,830 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGTGTCACAATTTCCAGAGGC -3'
(R):5'- TGACAAAGACTGATGGCCATAC -3'

Sequencing Primer
(F):5'- TGTCACAATTTCCAGAGGCAATGG -3'
(R):5'- GACTGATGGCCATACTGATCC -3'
Posted On 2015-04-17