Incidental Mutation 'R3886:Slitrk5'
ID 309667
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene Name SLIT and NTRK-like family, member 5
Synonyms 2610019D03Rik
MMRRC Submission 040798-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R3886 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 111912547-111920576 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 111917229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 284 (C284*)
Ref Sequence ENSEMBL: ENSMUSP00000041499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
AlphaFold Q810B7
Predicted Effect probably null
Transcript: ENSMUST00000042767
AA Change: C284*
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: C284*

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227891
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ccdc73 A T 2: 104,821,688 (GRCm39) T546S possibly damaging Het
Cd22 T C 7: 30,569,532 (GRCm39) D354G possibly damaging Het
Chchd6 T C 6: 89,444,433 (GRCm39) E183G probably damaging Het
Col6a5 A G 9: 105,808,129 (GRCm39) L973P unknown Het
Cp T C 3: 20,043,275 (GRCm39) L1021P probably damaging Het
Cplane1 T A 15: 8,201,289 (GRCm39) V22E probably damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
D630045J12Rik A G 6: 38,119,633 (GRCm39) V1703A possibly damaging Het
Dennd1a T C 2: 37,748,089 (GRCm39) N376S possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Ect2l C T 10: 18,044,206 (GRCm39) V310M probably damaging Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gm8674 T C 13: 50,056,199 (GRCm39) noncoding transcript Het
Ice1 T C 13: 70,753,489 (GRCm39) T866A probably benign Het
Jade2 C T 11: 51,721,326 (GRCm39) V201I possibly damaging Het
Kcnb2 T C 1: 15,780,639 (GRCm39) S504P probably damaging Het
Kcng4 T C 8: 120,359,986 (GRCm39) K130R probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrrk1 C T 7: 65,942,112 (GRCm39) V709I probably damaging Het
Mdh1 A G 11: 21,509,832 (GRCm39) V181A probably damaging Het
Or10g7 A G 9: 39,905,835 (GRCm39) H243R probably damaging Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Ppp1r3a A C 6: 14,719,911 (GRCm39) D334E possibly damaging Het
Pramel17 T C 4: 101,692,920 (GRCm39) K360R probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Relch A G 1: 105,619,938 (GRCm39) N331S probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G A 13: 38,082,482 (GRCm39) probably null Het
Slc35f2 T A 9: 53,724,241 (GRCm39) S372T probably benign Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Tent4b C A 8: 88,927,043 (GRCm39) A151E probably benign Het
Tnxb A G 17: 34,937,885 (GRCm39) D3896G probably damaging Het
Tti1 A G 2: 157,850,870 (GRCm39) V123A possibly damaging Het
Usp1 T C 4: 98,817,973 (GRCm39) C147R probably damaging Het
Vill A G 9: 118,895,782 (GRCm39) N106S probably benign Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111,918,097 (GRCm39) missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111,918,526 (GRCm39) missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111,916,432 (GRCm39) missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111,916,717 (GRCm39) missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111,918,026 (GRCm39) missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111,919,055 (GRCm39) missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111,918,256 (GRCm39) missense probably benign
R0392:Slitrk5 UTSW 14 111,916,465 (GRCm39) missense probably benign 0.06
R0659:Slitrk5 UTSW 14 111,918,121 (GRCm39) missense probably benign 0.00
R1344:Slitrk5 UTSW 14 111,917,821 (GRCm39) missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111,917,951 (GRCm39) missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111,917,821 (GRCm39) missense probably benign 0.04
R2070:Slitrk5 UTSW 14 111,917,621 (GRCm39) missense probably damaging 0.99
R2071:Slitrk5 UTSW 14 111,917,621 (GRCm39) missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111,917,014 (GRCm39) missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111,917,014 (GRCm39) missense probably damaging 1.00
R3003:Slitrk5 UTSW 14 111,917,014 (GRCm39) missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111,917,229 (GRCm39) nonsense probably null
R3888:Slitrk5 UTSW 14 111,917,229 (GRCm39) nonsense probably null
R4962:Slitrk5 UTSW 14 111,918,679 (GRCm39) missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111,917,648 (GRCm39) missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111,918,316 (GRCm39) missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111,916,852 (GRCm39) missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111,919,118 (GRCm39) missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111,919,055 (GRCm39) missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111,917,345 (GRCm39) missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111,917,030 (GRCm39) missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111,919,157 (GRCm39) missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111,917,248 (GRCm39) unclassified probably benign
R6225:Slitrk5 UTSW 14 111,917,248 (GRCm39) unclassified probably benign
R6230:Slitrk5 UTSW 14 111,917,248 (GRCm39) unclassified probably benign
R6337:Slitrk5 UTSW 14 111,917,684 (GRCm39) missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111,917,534 (GRCm39) missense probably damaging 0.96
R6818:Slitrk5 UTSW 14 111,917,726 (GRCm39) missense probably benign 0.32
R6895:Slitrk5 UTSW 14 111,919,085 (GRCm39) missense probably damaging 1.00
R7094:Slitrk5 UTSW 14 111,918,268 (GRCm39) missense probably benign 0.02
R7385:Slitrk5 UTSW 14 111,918,131 (GRCm39) missense probably benign 0.32
R8532:Slitrk5 UTSW 14 111,916,909 (GRCm39) missense probably benign
R8994:Slitrk5 UTSW 14 111,918,227 (GRCm39) missense probably benign 0.00
R9344:Slitrk5 UTSW 14 111,916,702 (GRCm39) missense probably damaging 0.97
R9374:Slitrk5 UTSW 14 111,916,496 (GRCm39) missense probably benign 0.23
R9499:Slitrk5 UTSW 14 111,916,496 (GRCm39) missense probably benign 0.23
R9500:Slitrk5 UTSW 14 111,916,726 (GRCm39) missense possibly damaging 0.89
R9512:Slitrk5 UTSW 14 111,917,252 (GRCm39) missense probably damaging 1.00
R9552:Slitrk5 UTSW 14 111,916,496 (GRCm39) missense probably benign 0.23
Z1177:Slitrk5 UTSW 14 111,917,285 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGTGGAATTACAGCTGGAGG -3'
(R):5'- GGGGCCATAGTTACTGTAGC -3'

Sequencing Primer
(F):5'- GAGGAAAACCCCTGGAATTGCTC -3'
(R):5'- GGCCATAGTTACTGTAGCCCAAGTC -3'
Posted On 2015-04-17