Incidental Mutation 'R3887:Rbm45'
ID309681
Institutional Source Beutler Lab
Gene Symbol Rbm45
Ensembl Gene ENSMUSG00000042369
Gene NameRNA binding motif protein 45
SynonymsG430095G15Rik, Drbp1, Drb1
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76369984-76383768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76375424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 207 (S207G)
Ref Sequence ENSEMBL: ENSMUSP00000040420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046389]
Predicted Effect probably benign
Transcript: ENSMUST00000046389
AA Change: S207G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040420
Gene: ENSMUSG00000042369
AA Change: S207G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RRM 27 102 2.08e-12 SMART
RRM 122 191 1.37e-12 SMART
RRM 249 320 2.27e-1 SMART
RRM 394 460 4.07e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif (RRM)-type RNA-binding family of proteins. This protein exhibits preferential binding to poly(C) RNA. Initial cloning of this gene found that the rat ortholog was dynamically expressed in the developing rat brain. This protein has been localized to inclusion bodies in the brain and spinal cord of amyotrophic lateral sclerosis and Alzheimer's patients. A pseudogene has been identified on chromosome 8. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Rbm45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Rbm45 APN 2 76378707 missense probably damaging 1.00
IGL03335:Rbm45 APN 2 76376433 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0382:Rbm45 UTSW 2 76370211 missense possibly damaging 0.92
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1533:Rbm45 UTSW 2 76372159 critical splice donor site probably null
R1942:Rbm45 UTSW 2 76375479 critical splice donor site probably null
R2046:Rbm45 UTSW 2 76375398 missense probably benign
R2912:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2913:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2929:Rbm45 UTSW 2 76378419 missense probably benign 0.00
R3418:Rbm45 UTSW 2 76379018 missense probably damaging 1.00
R3886:Rbm45 UTSW 2 76375424 missense probably benign
R3888:Rbm45 UTSW 2 76375424 missense probably benign
R4488:Rbm45 UTSW 2 76376396 missense probably damaging 0.99
R5369:Rbm45 UTSW 2 76370250 missense probably damaging 1.00
R5990:Rbm45 UTSW 2 76370412 missense probably benign 0.36
R6569:Rbm45 UTSW 2 76379072 missense probably damaging 1.00
R6806:Rbm45 UTSW 2 76380460 missense probably benign 0.19
R7022:Rbm45 UTSW 2 76376394 missense probably damaging 1.00
R7832:Rbm45 UTSW 2 76376453 missense possibly damaging 0.80
R8720:Rbm45 UTSW 2 76380367 missense probably damaging 1.00
R8933:Rbm45 UTSW 2 76378724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCATGTAAATTCTGCCTTGTATG -3'
(R):5'- TGTTAGAAGAACTGAGCAACTTCTC -3'

Sequencing Primer
(F):5'- CACGGGTTCTCATTTTCA -3'
(R):5'- CCCAGCAACATATCAGATTTTCATTC -3'
Posted On2015-04-17