Incidental Mutation 'R3887:Olfr1243'
ID309682
Institutional Source Beutler Lab
Gene Symbol Olfr1243
Ensembl Gene ENSMUSG00000075084
Gene Nameolfactory receptor 1243
SynonymsGA_x6K02T2Q125-50972538-50971621, MOR231-4
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89525889-89531487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89527732 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 226 (H226L)
Ref Sequence ENSEMBL: ENSMUSP00000149464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099775] [ENSMUST00000144885]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099775
AA Change: H226L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097363
Gene: ENSMUSG00000075084
AA Change: H226L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 2.1e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144885
AA Change: H226L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216635
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Olfr1243
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr1243 APN 2 89528207 missense probably damaging 1.00
IGL01940:Olfr1243 APN 2 89527810 missense probably damaging 0.99
IGL02553:Olfr1243 APN 2 89527931 missense probably benign
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0607:Olfr1243 UTSW 2 89528107 missense possibly damaging 0.88
R0764:Olfr1243 UTSW 2 89527996 missense probably benign 0.05
R1779:Olfr1243 UTSW 2 89527645 missense probably benign 0.15
R2221:Olfr1243 UTSW 2 89527937 missense probably benign 0.05
R3853:Olfr1243 UTSW 2 89527573 missense possibly damaging 0.94
R3886:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R3888:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R4431:Olfr1243 UTSW 2 89527643 missense probably damaging 1.00
R4479:Olfr1243 UTSW 2 89528170 missense possibly damaging 0.89
R6807:Olfr1243 UTSW 2 89527588 missense probably damaging 1.00
R7025:Olfr1243 UTSW 2 89527604 missense probably damaging 0.98
R7094:Olfr1243 UTSW 2 89527558 missense probably damaging 1.00
R7144:Olfr1243 UTSW 2 89527557 missense probably damaging 1.00
R7972:Olfr1243 UTSW 2 89527604 missense probably benign 0.02
R8013:Olfr1243 UTSW 2 89527936 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGCACAGCATCCCTTGTTAG -3'
(R):5'- CCAATGTCATTGATCACTTCATGTG -3'

Sequencing Primer
(F):5'- GCACAGCATCCCTTGTTAGAATTTAC -3'
(R):5'- GTGTGATATGAATCCATTACTGGGAC -3'
Posted On2015-04-17