Incidental Mutation 'R3887:Foxd2'
ID309684
Institutional Source Beutler Lab
Gene Symbol Foxd2
Ensembl Gene ENSMUSG00000055210
Gene Nameforkhead box D2
SynonymsMf2
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location114906282-114908873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114908286 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 179 (H179R)
Ref Sequence ENSEMBL: ENSMUSP00000066868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068654]
Predicted Effect unknown
Transcript: ENSMUST00000068654
AA Change: H179R
SMART Domains Protein: ENSMUSP00000066868
Gene: ENSMUSG00000055210
AA Change: H179R

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 82 126 N/A INTRINSIC
FH 127 217 1.01e-60 SMART
low complexity region 229 259 N/A INTRINSIC
low complexity region 263 304 N/A INTRINSIC
low complexity region 310 351 N/A INTRINSIC
low complexity region 365 384 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 416 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144002
Meta Mutation Damage Score 0.9067 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit renal abnormalities including kidney hypoplasia and hydroureter. Penetrance is reduced, and dependent upon the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Foxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1168:Foxd2 UTSW 4 114907678 missense possibly damaging 0.85
R1183:Foxd2 UTSW 4 114907465 missense possibly damaging 0.68
R1479:Foxd2 UTSW 4 114907918 missense unknown
R3885:Foxd2 UTSW 4 114908286 missense unknown
R3886:Foxd2 UTSW 4 114908286 missense unknown
R3888:Foxd2 UTSW 4 114908286 missense unknown
R3889:Foxd2 UTSW 4 114908286 missense unknown
R4874:Foxd2 UTSW 4 114907571 missense possibly damaging 0.53
R5646:Foxd2 UTSW 4 114908635 missense unknown
R6126:Foxd2 UTSW 4 114908505 missense unknown
R7235:Foxd2 UTSW 4 114908271 missense unknown
R7749:Foxd2 UTSW 4 114907812 missense unknown
Z1177:Foxd2 UTSW 4 114907887 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAAGCCTTGGCGCAAC -3'
(R):5'- ACGGAGCCCTCTGGTGAAA -3'

Sequencing Primer
(F):5'- ACTGACAGCTGGCAAGGC -3'
(R):5'- GTGAAACCACCTTATTCGTACATCG -3'
Posted On2015-04-17