Incidental Mutation 'R3887:Foxd2'
ID 309684
Institutional Source Beutler Lab
Gene Symbol Foxd2
Ensembl Gene ENSMUSG00000055210
Gene Name forkhead box D2
Synonyms Mf2
MMRRC Submission 040799-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.468) question?
Stock # R3887 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 114763479-114766070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114765483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 179 (H179R)
Ref Sequence ENSEMBL: ENSMUSP00000066868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068654]
AlphaFold O35392
Predicted Effect unknown
Transcript: ENSMUST00000068654
AA Change: H179R
SMART Domains Protein: ENSMUSP00000066868
Gene: ENSMUSG00000055210
AA Change: H179R

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 82 126 N/A INTRINSIC
FH 127 217 1.01e-60 SMART
low complexity region 229 259 N/A INTRINSIC
low complexity region 263 304 N/A INTRINSIC
low complexity region 310 351 N/A INTRINSIC
low complexity region 365 384 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 416 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144002
Meta Mutation Damage Score 0.9067 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit renal abnormalities including kidney hypoplasia and hydroureter. Penetrance is reduced, and dependent upon the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Ankdd1a C A 9: 65,409,530 (GRCm39) G469W probably damaging Het
Ano6 A C 15: 95,792,330 (GRCm39) T65P possibly damaging Het
Arhgap26 G A 18: 39,363,019 (GRCm39) probably null Het
Ccdc175 A G 12: 72,182,822 (GRCm39) I399T possibly damaging Het
Ceacam14 T A 7: 17,548,063 (GRCm39) V51D probably damaging Het
Cerk A T 15: 86,033,532 (GRCm39) I297N possibly damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Efcab14 T A 4: 115,595,857 (GRCm39) M1K probably null Het
Etl4 C T 2: 20,534,772 (GRCm39) Q76* probably null Het
Fmc1 T C 6: 38,516,223 (GRCm39) S90P probably benign Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Hk2 C T 6: 82,711,942 (GRCm39) D548N possibly damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrp5 G A 19: 3,662,330 (GRCm39) R173C probably damaging Het
Mapk12 A T 15: 89,019,840 (GRCm39) H122Q possibly damaging Het
Mdfic C T 6: 15,799,710 (GRCm39) T279I probably damaging Het
Mycbp2 A G 14: 103,412,233 (GRCm39) V2580A probably damaging Het
Mylk3 A G 8: 86,078,676 (GRCm39) I476T probably damaging Het
Ncapg G A 5: 45,831,705 (GRCm39) V184I probably benign Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Pla2g15 A G 8: 106,887,767 (GRCm39) Y185C probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Reln T C 5: 22,115,847 (GRCm39) I3054V possibly damaging Het
Rreb1 G T 13: 38,077,941 (GRCm39) R51L probably damaging Het
Scube2 A T 7: 109,442,383 (GRCm39) probably benign Het
Slc15a2 A G 16: 36,602,666 (GRCm39) F65S probably damaging Het
Slc17a8 G T 10: 89,427,000 (GRCm39) probably benign Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Stag3 A G 5: 138,297,101 (GRCm39) I550M probably damaging Het
Steap4 G T 5: 8,030,494 (GRCm39) R450L probably damaging Het
Strn4 T C 7: 16,556,923 (GRCm39) probably benign Het
Stxbp3 C T 3: 108,712,549 (GRCm39) probably null Het
Syngr1 A G 15: 80,000,240 (GRCm39) D117G probably damaging Het
Tbc1d10b A T 7: 126,798,967 (GRCm39) I513N possibly damaging Het
Other mutations in Foxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1168:Foxd2 UTSW 4 114,764,875 (GRCm39) missense possibly damaging 0.85
R1183:Foxd2 UTSW 4 114,764,662 (GRCm39) missense possibly damaging 0.68
R1479:Foxd2 UTSW 4 114,765,115 (GRCm39) missense unknown
R3885:Foxd2 UTSW 4 114,765,483 (GRCm39) missense unknown
R3886:Foxd2 UTSW 4 114,765,483 (GRCm39) missense unknown
R3888:Foxd2 UTSW 4 114,765,483 (GRCm39) missense unknown
R3889:Foxd2 UTSW 4 114,765,483 (GRCm39) missense unknown
R4874:Foxd2 UTSW 4 114,764,768 (GRCm39) missense possibly damaging 0.53
R5646:Foxd2 UTSW 4 114,765,832 (GRCm39) missense unknown
R6126:Foxd2 UTSW 4 114,765,702 (GRCm39) missense unknown
R7235:Foxd2 UTSW 4 114,765,468 (GRCm39) missense unknown
R7749:Foxd2 UTSW 4 114,765,009 (GRCm39) missense unknown
R9697:Foxd2 UTSW 4 114,765,684 (GRCm39) missense unknown
R9715:Foxd2 UTSW 4 114,765,195 (GRCm39) missense unknown
R9786:Foxd2 UTSW 4 114,764,850 (GRCm39) missense possibly damaging 0.86
Z1177:Foxd2 UTSW 4 114,765,084 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAAGCCTTGGCGCAAC -3'
(R):5'- ACGGAGCCCTCTGGTGAAA -3'

Sequencing Primer
(F):5'- ACTGACAGCTGGCAAGGC -3'
(R):5'- GTGAAACCACCTTATTCGTACATCG -3'
Posted On 2015-04-17