Incidental Mutation 'R3887:Mdfic'
ID309690
Institutional Source Beutler Lab
Gene Symbol Mdfic
Ensembl Gene ENSMUSG00000041390
Gene NameMyoD family inhibitor domain containing
Synonymsclone 1.5, Kdt1
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location15720661-15802169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15799711 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 279 (T279I)
Ref Sequence ENSEMBL: ENSMUSP00000140641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101663] [ENSMUST00000120512] [ENSMUST00000189359] [ENSMUST00000190255]
Predicted Effect probably damaging
Transcript: ENSMUST00000101663
AA Change: T197I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099186
Gene: ENSMUSG00000041390
AA Change: T197I

DomainStartEndE-ValueType
Pfam:MDFI 74 247 7.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120512
AA Change: T197I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113050
Gene: ENSMUSG00000041390
AA Change: T197I

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189359
AA Change: T197I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140208
Gene: ENSMUSG00000041390
AA Change: T197I

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190255
AA Change: T279I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140641
Gene: ENSMUSG00000041390
AA Change: T279I

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:MDFI 156 329 8.8e-73 PFAM
Meta Mutation Damage Score 0.1576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, which in human have been shown to have different subcellular localization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Mdfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mdfic APN 6 15741074 missense possibly damaging 0.95
IGL02184:Mdfic APN 6 15770367 missense possibly damaging 0.76
IGL03104:Mdfic APN 6 15770320 missense probably damaging 1.00
IGL03177:Mdfic APN 6 15770451 missense probably damaging 1.00
R0521:Mdfic UTSW 6 15799756 missense probably benign 0.07
R1549:Mdfic UTSW 6 15799845 missense probably damaging 1.00
R1613:Mdfic UTSW 6 15799590 splice site probably null
R2496:Mdfic UTSW 6 15741042 missense possibly damaging 0.92
R3087:Mdfic UTSW 6 15799669 missense probably damaging 1.00
R3623:Mdfic UTSW 6 15770320 missense probably damaging 1.00
R4736:Mdfic UTSW 6 15741020 missense possibly damaging 0.79
R5704:Mdfic UTSW 6 15770292 missense probably damaging 1.00
R6187:Mdfic UTSW 6 15721197 utr 5 prime probably benign
R6501:Mdfic UTSW 6 15770517 missense possibly damaging 0.48
R6517:Mdfic UTSW 6 15770325 missense probably damaging 1.00
R6521:Mdfic UTSW 6 15729028 intron probably benign
R7761:Mdfic UTSW 6 15728056 missense unknown
R7959:Mdfic UTSW 6 15741071 missense possibly damaging 0.84
R8196:Mdfic UTSW 6 15740990 missense probably benign 0.45
R8345:Mdfic UTSW 6 15799654 missense probably damaging 1.00
R8690:Mdfic UTSW 6 15799654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAGCTTTTACCCAGACTC -3'
(R):5'- ATGGGAGTCTTACCATGCGC -3'

Sequencing Primer
(F):5'- CAGACTCTGGATAACACGTGTG -3'
(R):5'- GGAGTCTTACCATGCGCCTTTC -3'
Posted On2015-04-17