Incidental Mutation 'R3887:Strn4'
ID309696
Institutional Source Beutler Lab
Gene Symbol Strn4
Ensembl Gene ENSMUSG00000030374
Gene Namestriatin, calmodulin binding protein 4
SynonymsZIN, zinedin
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16815889-16840931 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 16822998 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000108495]
Predicted Effect probably benign
Transcript: ENSMUST00000019220
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108495
SMART Domains Protein: ENSMUSP00000104135
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 197 1.4e-45 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
WD40 427 466 5.72e-9 SMART
WD40 480 519 6.53e-4 SMART
WD40 533 572 6.99e-13 SMART
WD40 577 619 2.38e1 SMART
WD40 622 665 3.55e1 SMART
WD40 668 707 5.34e-9 SMART
WD40 710 753 1.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138070
Predicted Effect probably benign
Transcript: ENSMUST00000184280
Predicted Effect probably benign
Transcript: ENSMUST00000184708
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Strn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Strn4 APN 7 16830452 missense probably damaging 1.00
IGL01153:Strn4 APN 7 16837921 missense probably damaging 1.00
IGL01748:Strn4 APN 7 16838302 missense probably damaging 1.00
IGL03227:Strn4 APN 7 16837714 missense possibly damaging 0.79
BB004:Strn4 UTSW 7 16826631 missense probably null 1.00
BB014:Strn4 UTSW 7 16826631 missense probably null 1.00
PIT4260001:Strn4 UTSW 7 16822509 missense probably damaging 1.00
R0948:Strn4 UTSW 7 16837713 nonsense probably null
R1876:Strn4 UTSW 7 16838282 missense probably damaging 1.00
R1918:Strn4 UTSW 7 16833921 missense probably damaging 1.00
R2015:Strn4 UTSW 7 16833028 missense possibly damaging 0.85
R2250:Strn4 UTSW 7 16826466 missense probably damaging 1.00
R3435:Strn4 UTSW 7 16837633 missense possibly damaging 0.86
R3686:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3688:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R4613:Strn4 UTSW 7 16824163 missense possibly damaging 0.50
R4730:Strn4 UTSW 7 16828794 missense possibly damaging 0.59
R5590:Strn4 UTSW 7 16833874 critical splice acceptor site probably null
R5924:Strn4 UTSW 7 16838321 missense probably damaging 1.00
R6327:Strn4 UTSW 7 16816459 missense probably benign 0.00
R6759:Strn4 UTSW 7 16823053 missense probably damaging 1.00
R6866:Strn4 UTSW 7 16828785 missense probably damaging 0.97
R6976:Strn4 UTSW 7 16830354 missense probably benign 0.20
R7759:Strn4 UTSW 7 16830384 missense probably damaging 1.00
R7779:Strn4 UTSW 7 16831492 missense probably damaging 1.00
R7927:Strn4 UTSW 7 16826631 missense probably null 1.00
R8174:Strn4 UTSW 7 16828808 missense probably damaging 1.00
R8777:Strn4 UTSW 7 16816608 missense probably damaging 1.00
R8777-TAIL:Strn4 UTSW 7 16816608 missense probably damaging 1.00
R8868:Strn4 UTSW 7 16826645 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACTATGTGCTCCAGTTCTGC -3'
(R):5'- CCCTGAGGTTGCAACTCTAC -3'

Sequencing Primer
(F):5'- TGCACAGCAGCTACCTTG -3'
(R):5'- TGAGGTTGCAACTCTACCCCAC -3'
Posted On2015-04-17