Incidental Mutation 'R3887:Tbc1d10b'
ID309700
Institutional Source Beutler Lab
Gene Symbol Tbc1d10b
Ensembl Gene ENSMUSG00000042492
Gene NameTBC1 domain family, member 10b
Synonyms
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127197459-127208468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127199795 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 513 (I513N)
Ref Sequence ENSEMBL: ENSMUSP00000113307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035771] [ENSMUST00000120705] [ENSMUST00000166791] [ENSMUST00000205316] [ENSMUST00000205321] [ENSMUST00000205355] [ENSMUST00000206026] [ENSMUST00000206587] [ENSMUST00000206081]
Predicted Effect probably benign
Transcript: ENSMUST00000035771
SMART Domains Protein: ENSMUSP00000044790
Gene: ENSMUSG00000042502

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120705
AA Change: I513N

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113307
Gene: ENSMUSG00000042492
AA Change: I513N

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Blast:TBC 274 305 6e-10 BLAST
TBC 343 557 8.23e-57 SMART
low complexity region 632 678 N/A INTRINSIC
coiled coil region 701 769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153857
Predicted Effect probably benign
Transcript: ENSMUST00000166791
SMART Domains Protein: ENSMUSP00000132963
Gene: ENSMUSG00000042502

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205316
Predicted Effect probably benign
Transcript: ENSMUST00000205321
Predicted Effect probably benign
Transcript: ENSMUST00000205355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205525
Predicted Effect probably benign
Transcript: ENSMUST00000205620
Predicted Effect probably benign
Transcript: ENSMUST00000206026
Predicted Effect probably benign
Transcript: ENSMUST00000206587
Predicted Effect probably benign
Transcript: ENSMUST00000206081
Meta Mutation Damage Score 0.9346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small G proteins of the RAB family (see MIM 179508) function in intracellular vesicle trafficking by switching from the GTP-bound state to the GDP-bound state with the assistance of guanine nucleotide exchange factors (GEFs; see MIM 609700) and GTPase-activating proteins (GAPs). TBC1D10B functions as a GAP for several proteins of the Rab family (Ishibashi et al., 2009 [PubMed 19077034]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Other mutations in Tbc1d10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Tbc1d10b APN 7 127199081 missense probably damaging 0.97
R0318:Tbc1d10b UTSW 7 127199034 missense probably damaging 1.00
R1480:Tbc1d10b UTSW 7 127203778 missense probably benign
R1793:Tbc1d10b UTSW 7 127203758 missense possibly damaging 0.48
R1971:Tbc1d10b UTSW 7 127207864 missense probably benign 0.37
R2520:Tbc1d10b UTSW 7 127200283 critical splice donor site probably null
R5517:Tbc1d10b UTSW 7 127198607 missense possibly damaging 0.93
R5780:Tbc1d10b UTSW 7 127198753 missense possibly damaging 0.58
R5912:Tbc1d10b UTSW 7 127199861 missense probably damaging 0.99
R6151:Tbc1d10b UTSW 7 127207996 missense probably damaging 1.00
R6358:Tbc1d10b UTSW 7 127203412 missense probably benign 0.02
R6480:Tbc1d10b UTSW 7 127198878 missense probably damaging 0.99
R7075:Tbc1d10b UTSW 7 127203238 missense possibly damaging 0.90
R7731:Tbc1d10b UTSW 7 127198821 missense probably benign
R8004:Tbc1d10b UTSW 7 127199011 missense probably damaging 1.00
R8910:Tbc1d10b UTSW 7 127207766 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCAGACTCTAGGCTGGTG -3'
(R):5'- AGCCTCTTAGGTTTGATTGTACC -3'

Sequencing Primer
(F):5'- CAAGATAGGCCCTGTTTTTCCAAAC -3'
(R):5'- CCTCTTAGGTTTGATTGTACCCTGAG -3'
Posted On2015-04-17