Incidental Mutation 'R3887:Mapk12'
ID309711
Institutional Source Beutler Lab
Gene Symbol Mapk12
Ensembl Gene ENSMUSG00000022610
Gene Namemitogen-activated protein kinase 12
SynonymsSapk3, P38gamma, Erk6, Prkm12
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89130584-89140703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89135637 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 122 (H122Q)
Ref Sequence ENSEMBL: ENSMUSP00000086207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088827]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088827
AA Change: H122Q

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610
AA Change: H122Q

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231056
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activation of members of the mitogen-activated protein kinase family is a major mechanism for transduction of extracellular signals. Stress-activated protein kinases are one subclass of MAP kinases. The protein encoded by this gene functions as a signal transducer during differentiation of myoblasts to myotubes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities. Mice homozygous for a conditional allele activated in muscle cell exhibit decreased endurance exercise-induced mitochondrial biogenesis and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Arhgap26 G A 18: 39,229,966 probably null Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Mapk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Mapk12 APN 15 89137466 splice site probably benign
revenge UTSW 15 89133147 missense probably damaging 1.00
R0106:Mapk12 UTSW 15 89132984 unclassified probably benign
R0106:Mapk12 UTSW 15 89132984 unclassified probably benign
R0523:Mapk12 UTSW 15 89135645 missense probably benign 0.12
R1148:Mapk12 UTSW 15 89134623 missense probably damaging 1.00
R1148:Mapk12 UTSW 15 89134623 missense probably damaging 1.00
R1667:Mapk12 UTSW 15 89140141 missense probably damaging 1.00
R4901:Mapk12 UTSW 15 89134638 nonsense probably null
R7011:Mapk12 UTSW 15 89135600 missense probably damaging 1.00
R7080:Mapk12 UTSW 15 89133147 missense probably damaging 1.00
R7105:Mapk12 UTSW 15 89131158 missense probably benign
X0022:Mapk12 UTSW 15 89137427 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACACCAGCCGCATGGATATAC -3'
(R):5'- TTGTCAAGGACAGTGTGCC -3'

Sequencing Primer
(F):5'- CCGCATGGATATACTGGGG -3'
(R):5'- GTGATGAATGGACACTCTAGG -3'
Posted On2015-04-17