Incidental Mutation 'R3887:Arhgap26'
ID 309714
Institutional Source Beutler Lab
Gene Symbol Arhgap26
Ensembl Gene ENSMUSG00000036452
Gene Name Rho GTPase activating protein 26
Synonyms 4933432P15Rik, 2610010G17Rik, 1810044B20Rik
MMRRC Submission 040799-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3887 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 38734531-39509338 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 39363019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000155576]
AlphaFold Q6ZQ82
Predicted Effect probably null
Transcript: ENSMUST00000097593
SMART Domains Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 1.8e-90 PFAM
Pfam:IMD 26 231 2.8e-9 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 701 N/A INTRINSIC
SH3 759 814 5.11e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154551
SMART Domains Protein: ENSMUSP00000123145
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
RhoGAP 6 184 4.51e-65 SMART
low complexity region 203 219 N/A INTRINSIC
low complexity region 236 271 N/A INTRINSIC
low complexity region 276 317 N/A INTRINSIC
SH3 333 388 5.11e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155576
SMART Domains Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
Pfam:IMD 27 232 1.2e-8 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 702 N/A INTRINSIC
SH3 704 759 5.11e-14 SMART
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Ankdd1a C A 9: 65,409,530 (GRCm39) G469W probably damaging Het
Ano6 A C 15: 95,792,330 (GRCm39) T65P possibly damaging Het
Ccdc175 A G 12: 72,182,822 (GRCm39) I399T possibly damaging Het
Ceacam14 T A 7: 17,548,063 (GRCm39) V51D probably damaging Het
Cerk A T 15: 86,033,532 (GRCm39) I297N possibly damaging Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Efcab14 T A 4: 115,595,857 (GRCm39) M1K probably null Het
Etl4 C T 2: 20,534,772 (GRCm39) Q76* probably null Het
Fmc1 T C 6: 38,516,223 (GRCm39) S90P probably benign Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Hk2 C T 6: 82,711,942 (GRCm39) D548N possibly damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrp5 G A 19: 3,662,330 (GRCm39) R173C probably damaging Het
Mapk12 A T 15: 89,019,840 (GRCm39) H122Q possibly damaging Het
Mdfic C T 6: 15,799,710 (GRCm39) T279I probably damaging Het
Mycbp2 A G 14: 103,412,233 (GRCm39) V2580A probably damaging Het
Mylk3 A G 8: 86,078,676 (GRCm39) I476T probably damaging Het
Ncapg G A 5: 45,831,705 (GRCm39) V184I probably benign Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Pla2g15 A G 8: 106,887,767 (GRCm39) Y185C probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Reln T C 5: 22,115,847 (GRCm39) I3054V possibly damaging Het
Rreb1 G T 13: 38,077,941 (GRCm39) R51L probably damaging Het
Scube2 A T 7: 109,442,383 (GRCm39) probably benign Het
Slc15a2 A G 16: 36,602,666 (GRCm39) F65S probably damaging Het
Slc17a8 G T 10: 89,427,000 (GRCm39) probably benign Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Stag3 A G 5: 138,297,101 (GRCm39) I550M probably damaging Het
Steap4 G T 5: 8,030,494 (GRCm39) R450L probably damaging Het
Strn4 T C 7: 16,556,923 (GRCm39) probably benign Het
Stxbp3 C T 3: 108,712,549 (GRCm39) probably null Het
Syngr1 A G 15: 80,000,240 (GRCm39) D117G probably damaging Het
Tbc1d10b A T 7: 126,798,967 (GRCm39) I513N possibly damaging Het
Other mutations in Arhgap26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Arhgap26 APN 18 39,419,604 (GRCm39) missense probably damaging 1.00
IGL01116:Arhgap26 APN 18 39,244,856 (GRCm39) missense probably damaging 0.97
IGL01409:Arhgap26 APN 18 39,243,504 (GRCm39) splice site probably benign
IGL02316:Arhgap26 APN 18 38,775,599 (GRCm39) exon noncoding transcript
IGL02418:Arhgap26 APN 18 39,490,620 (GRCm39) intron probably benign
IGL02588:Arhgap26 APN 18 38,734,670 (GRCm39) unclassified probably benign
IGL03241:Arhgap26 APN 18 39,362,970 (GRCm39) missense probably damaging 1.00
R0184:Arhgap26 UTSW 18 38,750,726 (GRCm39) missense unknown
R0244:Arhgap26 UTSW 18 39,496,184 (GRCm39) missense probably benign 0.05
R0347:Arhgap26 UTSW 18 38,750,797 (GRCm39) missense unknown
R1533:Arhgap26 UTSW 18 39,504,130 (GRCm39) missense probably benign 0.16
R1606:Arhgap26 UTSW 18 39,429,925 (GRCm39) missense probably damaging 1.00
R2066:Arhgap26 UTSW 18 39,439,781 (GRCm39) missense probably damaging 1.00
R2182:Arhgap26 UTSW 18 39,490,862 (GRCm39) intron probably benign
R2291:Arhgap26 UTSW 18 39,490,751 (GRCm39) intron probably benign
R3611:Arhgap26 UTSW 18 39,066,972 (GRCm39) missense probably benign
R3700:Arhgap26 UTSW 18 39,253,237 (GRCm39) missense probably damaging 0.99
R4621:Arhgap26 UTSW 18 39,032,894 (GRCm39) intron probably benign
R4877:Arhgap26 UTSW 18 39,429,982 (GRCm39) splice site probably null
R4910:Arhgap26 UTSW 18 39,126,690 (GRCm39) splice site probably benign
R4911:Arhgap26 UTSW 18 39,126,690 (GRCm39) splice site probably benign
R4954:Arhgap26 UTSW 18 39,376,694 (GRCm39) missense probably benign 0.00
R4967:Arhgap26 UTSW 18 39,379,893 (GRCm39) missense probably damaging 1.00
R5221:Arhgap26 UTSW 18 39,243,525 (GRCm39) nonsense probably null
R5232:Arhgap26 UTSW 18 39,126,529 (GRCm39) start codon destroyed probably null 0.97
R5297:Arhgap26 UTSW 18 39,254,941 (GRCm39) missense probably damaging 1.00
R5372:Arhgap26 UTSW 18 38,775,509 (GRCm39) exon noncoding transcript
R5570:Arhgap26 UTSW 18 39,232,671 (GRCm39) missense probably damaging 0.99
R5692:Arhgap26 UTSW 18 39,254,945 (GRCm39) missense probably damaging 1.00
R5752:Arhgap26 UTSW 18 39,419,725 (GRCm39) missense probably damaging 1.00
R5930:Arhgap26 UTSW 18 39,283,145 (GRCm39) missense probably damaging 0.96
R6131:Arhgap26 UTSW 18 39,419,638 (GRCm39) nonsense probably null
R6251:Arhgap26 UTSW 18 39,490,880 (GRCm39) missense probably null
R6481:Arhgap26 UTSW 18 39,283,110 (GRCm39) missense probably damaging 1.00
R6622:Arhgap26 UTSW 18 39,032,916 (GRCm39) intron probably benign
R6799:Arhgap26 UTSW 18 39,232,660 (GRCm39) missense probably damaging 1.00
R6878:Arhgap26 UTSW 18 39,360,465 (GRCm39) missense probably damaging 1.00
R6989:Arhgap26 UTSW 18 39,232,682 (GRCm39) missense probably damaging 1.00
R7248:Arhgap26 UTSW 18 39,439,907 (GRCm39) critical splice donor site probably null
R7936:Arhgap26 UTSW 18 39,338,340 (GRCm39) missense probably damaging 1.00
R7960:Arhgap26 UTSW 18 39,362,980 (GRCm39) missense
R8103:Arhgap26 UTSW 18 39,504,177 (GRCm39) missense
R8206:Arhgap26 UTSW 18 39,439,803 (GRCm39) nonsense probably null
R8356:Arhgap26 UTSW 18 39,244,901 (GRCm39) missense possibly damaging 0.89
R8456:Arhgap26 UTSW 18 39,244,901 (GRCm39) missense possibly damaging 0.89
R8987:Arhgap26 UTSW 18 39,490,652 (GRCm39) missense
R9025:Arhgap26 UTSW 18 39,379,898 (GRCm39) missense
R9149:Arhgap26 UTSW 18 39,244,917 (GRCm39) missense possibly damaging 0.94
R9172:Arhgap26 UTSW 18 39,378,382 (GRCm39) missense probably damaging 1.00
R9191:Arhgap26 UTSW 18 39,439,893 (GRCm39) missense
R9576:Arhgap26 UTSW 18 39,253,207 (GRCm39) nonsense probably null
X0013:Arhgap26 UTSW 18 39,504,165 (GRCm39) missense probably damaging 1.00
X0025:Arhgap26 UTSW 18 39,283,158 (GRCm39) missense probably damaging 1.00
Z1088:Arhgap26 UTSW 18 39,490,724 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- TTACAGCAGCTTTTAGGAGGAG -3'
(R):5'- AGACTGTGAGATGCTTGGTCC -3'

Sequencing Primer
(F):5'- CAGCTTTTAGGAGGAGAGAGAAAATG -3'
(R):5'- TTTCAATGTTACAAAGGCCCACTC -3'
Posted On 2015-04-17