Incidental Mutation 'R3887:Arhgap26'
ID309714
Institutional Source Beutler Lab
Gene Symbol Arhgap26
Ensembl Gene ENSMUSG00000036452
Gene NameRho GTPase activating protein 26
Synonyms2610010G17Rik, 1810044B20Rik, 4933432P15Rik
MMRRC Submission 040799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3887 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38601534-39376284 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 39229966 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000155576]
Predicted Effect probably null
Transcript: ENSMUST00000097593
SMART Domains Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 1.8e-90 PFAM
Pfam:IMD 26 231 2.8e-9 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 701 N/A INTRINSIC
SH3 759 814 5.11e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154551
SMART Domains Protein: ENSMUSP00000123145
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
RhoGAP 6 184 4.51e-65 SMART
low complexity region 203 219 N/A INTRINSIC
low complexity region 236 271 N/A INTRINSIC
low complexity region 276 317 N/A INTRINSIC
SH3 333 388 5.11e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155576
SMART Domains Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
Pfam:IMD 27 232 1.2e-8 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 702 N/A INTRINSIC
SH3 704 759 5.11e-14 SMART
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Ankdd1a C A 9: 65,502,248 G469W probably damaging Het
Ano6 A C 15: 95,894,449 T65P possibly damaging Het
Ccdc175 A G 12: 72,136,048 I399T possibly damaging Het
Ceacam14 T A 7: 17,814,138 V51D probably damaging Het
Cerk A T 15: 86,149,331 I297N possibly damaging Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Efcab14 T A 4: 115,738,660 M1K probably null Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fmc1 T C 6: 38,539,288 S90P probably benign Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Hk2 C T 6: 82,734,961 D548N possibly damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Mapk12 A T 15: 89,135,637 H122Q possibly damaging Het
Mdfic C T 6: 15,799,711 T279I probably damaging Het
Mycbp2 A G 14: 103,174,797 V2580A probably damaging Het
Mylk3 A G 8: 85,352,047 I476T probably damaging Het
Ncapg G A 5: 45,674,363 V184I probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Pla2g15 A G 8: 106,161,135 Y185C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Reln T C 5: 21,910,849 I3054V possibly damaging Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Scube2 A T 7: 109,843,176 probably benign Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slc17a8 G T 10: 89,591,138 probably benign Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Stag3 A G 5: 138,298,839 I550M probably damaging Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Strn4 T C 7: 16,822,998 probably benign Het
Stxbp3 C T 3: 108,805,233 probably null Het
Syngr1 A G 15: 80,116,039 D117G probably damaging Het
Tbc1d10b A T 7: 127,199,795 I513N possibly damaging Het
Other mutations in Arhgap26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Arhgap26 APN 18 39286551 missense probably damaging 1.00
IGL01116:Arhgap26 APN 18 39111803 missense probably damaging 0.97
IGL01409:Arhgap26 APN 18 39110451 splice site probably benign
IGL02316:Arhgap26 APN 18 38642546 exon noncoding transcript
IGL02418:Arhgap26 APN 18 39357567 intron probably benign
IGL02588:Arhgap26 APN 18 38601617 unclassified probably benign
IGL03241:Arhgap26 APN 18 39229917 missense probably damaging 1.00
R0184:Arhgap26 UTSW 18 38617673 missense unknown
R0244:Arhgap26 UTSW 18 39363131 missense probably benign 0.05
R0347:Arhgap26 UTSW 18 38617744 missense unknown
R1533:Arhgap26 UTSW 18 39371077 missense probably benign 0.16
R1606:Arhgap26 UTSW 18 39296872 missense probably damaging 1.00
R2066:Arhgap26 UTSW 18 39306728 missense probably damaging 1.00
R2182:Arhgap26 UTSW 18 39357809 intron probably benign
R2291:Arhgap26 UTSW 18 39357698 intron probably benign
R3611:Arhgap26 UTSW 18 38933919 missense probably benign
R3700:Arhgap26 UTSW 18 39120184 missense probably damaging 0.99
R4621:Arhgap26 UTSW 18 38899841 intron probably benign
R4877:Arhgap26 UTSW 18 39296929 splice site probably null
R4910:Arhgap26 UTSW 18 38993637 splice site probably benign
R4911:Arhgap26 UTSW 18 38993637 splice site probably benign
R4954:Arhgap26 UTSW 18 39243641 missense probably benign 0.00
R4967:Arhgap26 UTSW 18 39246840 missense probably damaging 1.00
R5221:Arhgap26 UTSW 18 39110472 nonsense probably null
R5232:Arhgap26 UTSW 18 38993476 start codon destroyed probably null 0.97
R5297:Arhgap26 UTSW 18 39121888 missense probably damaging 1.00
R5372:Arhgap26 UTSW 18 38642456 exon noncoding transcript
R5570:Arhgap26 UTSW 18 39099618 missense probably damaging 0.99
R5692:Arhgap26 UTSW 18 39121892 missense probably damaging 1.00
R5752:Arhgap26 UTSW 18 39286672 missense probably damaging 1.00
R5930:Arhgap26 UTSW 18 39150092 missense probably damaging 0.96
R6131:Arhgap26 UTSW 18 39286585 nonsense probably null
R6251:Arhgap26 UTSW 18 39357827 missense probably null
R6481:Arhgap26 UTSW 18 39150057 missense probably damaging 1.00
R6622:Arhgap26 UTSW 18 38899863 intron probably benign
R6799:Arhgap26 UTSW 18 39099607 missense probably damaging 1.00
R6878:Arhgap26 UTSW 18 39227412 missense probably damaging 1.00
R6989:Arhgap26 UTSW 18 39099629 missense probably damaging 1.00
R7248:Arhgap26 UTSW 18 39306854 critical splice donor site probably null
R7936:Arhgap26 UTSW 18 39205287 missense probably damaging 1.00
R7960:Arhgap26 UTSW 18 39229927 missense
R8103:Arhgap26 UTSW 18 39371124 missense
R8206:Arhgap26 UTSW 18 39306750 nonsense probably null
R8356:Arhgap26 UTSW 18 39111848 missense possibly damaging 0.89
R8456:Arhgap26 UTSW 18 39111848 missense possibly damaging 0.89
X0013:Arhgap26 UTSW 18 39371112 missense probably damaging 1.00
X0025:Arhgap26 UTSW 18 39150105 missense probably damaging 1.00
Z1088:Arhgap26 UTSW 18 39357671 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TTACAGCAGCTTTTAGGAGGAG -3'
(R):5'- AGACTGTGAGATGCTTGGTCC -3'

Sequencing Primer
(F):5'- CAGCTTTTAGGAGGAGAGAGAAAATG -3'
(R):5'- TTTCAATGTTACAAAGGCCCACTC -3'
Posted On2015-04-17